ID: 1037828925

View in Genome Browser
Species Human (GRCh38)
Location 8:22176971-22176993
Sequence TACGTGGGTCGCCGCGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 50}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828919_1037828925 -9 Left 1037828919 8:22176957-22176979 CCAGGTGCTGCTCCTACGTGGGT 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828901_1037828925 30 Left 1037828901 8:22176918-22176940 CCCCAGCTCGGGACCGCCCCCCT 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828913_1037828925 -1 Left 1037828913 8:22176949-22176971 CCCGCCCTCCAGGTGCTGCTCCT 0: 1
1: 1
2: 6
3: 72
4: 639
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828906_1037828925 14 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828915_1037828925 -5 Left 1037828915 8:22176953-22176975 CCCTCCAGGTGCTGCTCCTACGT 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828903_1037828925 28 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828902_1037828925 29 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828908_1037828925 12 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828912_1037828925 0 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828916_1037828925 -6 Left 1037828916 8:22176954-22176976 CCTCCAGGTGCTGCTCCTACGTG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828910_1037828925 10 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828907_1037828925 13 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828905_1037828925 17 Left 1037828905 8:22176931-22176953 CCGCCCCCCTGAGCTGGCCCCGC 0: 1
1: 0
2: 1
3: 55
4: 478
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828909_1037828925 11 Left 1037828909 8:22176937-22176959 CCCTGAGCTGGCCCCGCCCTCCA 0: 1
1: 0
2: 3
3: 37
4: 334
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828914_1037828925 -2 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828925 Original CRISPR TACGTGGGTCGCCGCGGCGG GGG Exonic
904646169 1:31968223-31968245 TACTTGGGAGGCTGCGGCGGAGG + Intergenic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
920827091 1:209432270-209432292 TACGGTGGTGGCGGCGGCGGTGG - Intergenic
1064354286 10:14603992-14604014 TGCGGGGGGCGCCGCGGAGGCGG - Intronic
1083033492 11:59615499-59615521 GACGGTGGTCGCGGCGGCGGCGG - Exonic
1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG + Exonic
1090635806 11:128689871-128689893 TACGTGGGAGGCCGCGGCGGCGG - Intronic
1096156833 12:49345737-49345759 TACCCGGGTCTCCCCGGCGGGGG - Intergenic
1102913764 12:116737910-116737932 GACGTGGGGCGCGGCGGCCGGGG + Exonic
1139580923 16:67873200-67873222 TGCGTGGTGCGCGGCGGCGGCGG + Exonic
1139826064 16:69758184-69758206 TACTTGGGTGGCCGAGGCAGGGG - Intergenic
1142188597 16:88706579-88706601 TACCTGGGCCGCGGCGCCGGGGG - Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1147571163 17:41571943-41571965 TACTTGAGCCGCAGCGGCGGGGG - Exonic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1154303910 18:13217504-13217526 TACCGGGGCCGCCGTGGCGGGGG - Intronic
1155467222 18:26150445-26150467 TACTTGGGAGGCTGCGGCGGGGG - Intronic
1160853551 19:1206055-1206077 TCCGCGGGGCGGCGCGGCGGCGG - Intronic
1166802814 19:45468693-45468715 TACCTGGGAGGCGGCGGCGGTGG - Exonic
1167258108 19:48443027-48443049 GACGGCGGTGGCCGCGGCGGCGG - Exonic
928606108 2:32946758-32946780 CCCGTGGGTCGCCGAGGCGGAGG - Intergenic
931355837 2:61537472-61537494 GGCGTGGGGCGCGGCGGCGGCGG - Intronic
933666712 2:84970826-84970848 TACGCGCGGCGCGGCGGCGGCGG + Intergenic
942241043 2:173964490-173964512 GACGTGGATAGCGGCGGCGGCGG - Exonic
947741394 2:232486577-232486599 TACGTGAGCCGCTGCGGCGCGGG - Exonic
1176359461 21:5982828-5982850 TGGGTGGGTCGCAGCGGTGGTGG + Intergenic
1179764057 21:43555722-43555744 TGGGTGGGTCGCAGCGGTGGTGG - Intronic
1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG + Exonic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
954176233 3:48847814-48847836 CCCGTCGGTCCCCGCGGCGGCGG - Exonic
962301883 3:134250631-134250653 TGCGTGGGGCGGCGCGGCTGGGG - Exonic
968515009 4:1012108-1012130 CACGTGGGGCGCGGGGGCGGGGG - Intronic
986451441 5:7869342-7869364 TCCGGGGGTCGCCGCGGGCGCGG + Intronic
990954875 5:61331782-61331804 CTCGTGGGTCGCAGCGGGGGAGG - Intergenic
999689951 5:154138219-154138241 TACCTGGGAGGCCGAGGCGGAGG + Intronic
1018686128 6:166306748-166306770 CAGGTGGGTGGCCGCGACGGTGG - Exonic
1018812443 6:167307773-167307795 CACGTGGGTCACCGCGCCTGGGG - Exonic
1020117085 7:5481960-5481982 TACATGGGTGGCCACGGAGGGGG + Intronic
1030219034 7:107078090-107078112 TACTTGGGAGGCCGAGGCGGAGG + Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1045124035 8:99070012-99070034 TACTTGGGATGCCGTGGCGGGGG - Intronic
1053071208 9:35103098-35103120 TCCGGAGGTCGCTGCGGCGGTGG - Exonic
1056921179 9:90790541-90790563 TACGTGGGAGGCTGAGGCGGGGG - Intergenic
1058893549 9:109381361-109381383 TAGGTGGGTCGGTGCGGGGGAGG + Intronic
1060814071 9:126625708-126625730 GACGAGGGTGGCGGCGGCGGCGG - Intronic
1061038704 9:128127620-128127642 TGCGTGGGTAGCAGCGGCTGGGG + Exonic
1062332297 9:136050042-136050064 GACGTAGGGGGCCGCGGCGGCGG + Exonic
1196734981 X:118975200-118975222 GACGGGGGCCGCCGCGGCTGCGG + Exonic
1200408192 Y:2836206-2836228 TACTTGGGTGGCTGAGGCGGGGG - Intergenic