ID: 1037828925

View in Genome Browser
Species Human (GRCh38)
Location 8:22176971-22176993
Sequence TACGTGGGTCGCCGCGGCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 50}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037828914_1037828925 -2 Left 1037828914 8:22176950-22176972 CCGCCCTCCAGGTGCTGCTCCTA 0: 1
1: 0
2: 3
3: 45
4: 374
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828907_1037828925 13 Left 1037828907 8:22176935-22176957 CCCCCTGAGCTGGCCCCGCCCTC 0: 1
1: 0
2: 5
3: 50
4: 415
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828915_1037828925 -5 Left 1037828915 8:22176953-22176975 CCCTCCAGGTGCTGCTCCTACGT 0: 1
1: 0
2: 1
3: 12
4: 116
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828905_1037828925 17 Left 1037828905 8:22176931-22176953 CCGCCCCCCTGAGCTGGCCCCGC 0: 1
1: 0
2: 1
3: 55
4: 478
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828906_1037828925 14 Left 1037828906 8:22176934-22176956 CCCCCCTGAGCTGGCCCCGCCCT 0: 1
1: 0
2: 4
3: 87
4: 444
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828909_1037828925 11 Left 1037828909 8:22176937-22176959 CCCTGAGCTGGCCCCGCCCTCCA 0: 1
1: 0
2: 3
3: 37
4: 334
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828902_1037828925 29 Left 1037828902 8:22176919-22176941 CCCAGCTCGGGACCGCCCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828908_1037828925 12 Left 1037828908 8:22176936-22176958 CCCCTGAGCTGGCCCCGCCCTCC 0: 1
1: 0
2: 4
3: 53
4: 480
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828919_1037828925 -9 Left 1037828919 8:22176957-22176979 CCAGGTGCTGCTCCTACGTGGGT 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828903_1037828925 28 Left 1037828903 8:22176920-22176942 CCAGCTCGGGACCGCCCCCCTGA 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828913_1037828925 -1 Left 1037828913 8:22176949-22176971 CCCGCCCTCCAGGTGCTGCTCCT 0: 1
1: 1
2: 6
3: 72
4: 639
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828910_1037828925 10 Left 1037828910 8:22176938-22176960 CCTGAGCTGGCCCCGCCCTCCAG 0: 1
1: 0
2: 3
3: 51
4: 410
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828912_1037828925 0 Left 1037828912 8:22176948-22176970 CCCCGCCCTCCAGGTGCTGCTCC 0: 1
1: 0
2: 5
3: 67
4: 516
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828916_1037828925 -6 Left 1037828916 8:22176954-22176976 CCTCCAGGTGCTGCTCCTACGTG 0: 1
1: 0
2: 2
3: 10
4: 131
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50
1037828901_1037828925 30 Left 1037828901 8:22176918-22176940 CCCCAGCTCGGGACCGCCCCCCT 0: 1
1: 0
2: 0
3: 13
4: 157
Right 1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG 0: 1
1: 0
2: 1
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037828925 Original CRISPR TACGTGGGTCGCCGCGGCGG GGG Exonic