ID: 1037829459

View in Genome Browser
Species Human (GRCh38)
Location 8:22179224-22179246
Sequence ATCTGAAAGCACCTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 270}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037829459_1037829462 -4 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829462 8:22179243-22179265 AGATGCAGCCTGTGCCAGCAGGG No data
1037829459_1037829469 14 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829469 8:22179261-22179283 CAGGGTGAGGAGCTGGCCTGGGG No data
1037829459_1037829470 22 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829470 8:22179269-22179291 GGAGCTGGCCTGGGGAGTCCTGG No data
1037829459_1037829467 12 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829467 8:22179259-22179281 AGCAGGGTGAGGAGCTGGCCTGG No data
1037829459_1037829468 13 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829468 8:22179260-22179282 GCAGGGTGAGGAGCTGGCCTGGG No data
1037829459_1037829465 7 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829465 8:22179254-22179276 GTGCCAGCAGGGTGAGGAGCTGG No data
1037829459_1037829461 -5 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829461 8:22179242-22179264 CAGATGCAGCCTGTGCCAGCAGG No data
1037829459_1037829463 1 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829463 8:22179248-22179270 CAGCCTGTGCCAGCAGGGTGAGG No data
1037829459_1037829471 23 Left 1037829459 8:22179224-22179246 CCTTGTTCCAGGTGCTTTCAGAT 0: 1
1: 0
2: 2
3: 23
4: 270
Right 1037829471 8:22179270-22179292 GAGCTGGCCTGGGGAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037829459 Original CRISPR ATCTGAAAGCACCTGGAACA AGG (reversed) Intronic
902091971 1:13910770-13910792 ATGGGAAAGCACCTGGAAATTGG - Intergenic
902595650 1:17507915-17507937 TTATGAAAGCACCTGGCACTTGG + Intergenic
903118370 1:21196744-21196766 ATATGCAAGCAACTGGAAGAAGG - Intergenic
904694757 1:32322959-32322981 ATGTGAAAGGACTTGGAAAAGGG + Intronic
905633367 1:39531469-39531491 CTCTGAAAACACCTGGGACCTGG + Intergenic
905776366 1:40669866-40669888 TTCTGAGAGCACCTTGAACTGGG - Intergenic
905861441 1:41354680-41354702 ATCTGCCAGCACCTGGATCTTGG - Intergenic
906800450 1:48732629-48732651 AACAGAAAGGACCTGGAAGAAGG + Intronic
907761222 1:57362705-57362727 ATCTGTCAGCACCTGGATCCTGG + Intronic
907867623 1:58413539-58413561 ATCTGACAGCAGCTGGGAAAGGG + Intronic
909478188 1:76106115-76106137 ATATGAAAACACCTGGCATAGGG + Intronic
910772594 1:90844986-90845008 AACTGAAAGCTCCTTGAAGATGG + Intergenic
915939177 1:160107795-160107817 ATCTGCCAGCACCTGGATCTTGG - Intergenic
916712854 1:167427321-167427343 ATGTGAAAACACTTGGAAGATGG - Exonic
916878121 1:168992158-168992180 TCCTGAAAGAACTTGGAACAGGG - Intergenic
917043582 1:170832834-170832856 ATGTGGAAGCAACTGGAACTGGG + Intergenic
920326207 1:205166546-205166568 CTCAGAAAGCACTTAGAACAAGG + Intronic
920790106 1:209081953-209081975 ATCTGCCAGCACCTTGATCATGG - Intergenic
920831219 1:209467346-209467368 ATCTGCCAGCACCTGGATCTCGG + Intergenic
921432241 1:215079055-215079077 ATCTGAAAGCACCAGAATAAGGG + Intronic
922218403 1:223539434-223539456 ATCTGAGACCTTCTGGAACACGG - Intronic
922604619 1:226881877-226881899 CTCTGGAAGCACCTGGAAAAAGG - Exonic
1064683597 10:17836174-17836196 ATCTGAAAATAGCTGGAAAAAGG - Intronic
1067914635 10:50384069-50384091 ATCAGCTAGCACCTGGATCATGG + Intronic
1067953436 10:50766272-50766294 TTGTTAAAGCATCTGGAACATGG + Intronic
1068736324 10:60417274-60417296 TTCTCAAACCACCTGGATCATGG - Intronic
1069336654 10:67359138-67359160 CTCTGAAAGCACCTAGAAAAAGG + Intronic
1069846287 10:71374080-71374102 ATATGAAAACACCTGGTATAGGG + Intergenic
1070362100 10:75700713-75700735 ATGTGAAAACTCCTGGAACATGG + Intronic
1071993816 10:91127441-91127463 CTCATAAAGCACCTGGAAAACGG + Intergenic
1072182313 10:92998193-92998215 ATCCAAAAGCACATGTAACAAGG - Intronic
1074383914 10:113002189-113002211 AACTGAAAACATCTGGATCAGGG - Intronic
1074477288 10:113784665-113784687 ATCTGACTGCAGGTGGAACAGGG + Intergenic
1076982418 11:211777-211799 TTCTGCAAGCTCCTGGAAGATGG - Intronic
1077975091 11:7239551-7239573 CCCTCAAAGCACCTGGAAGAAGG + Intronic
1078404374 11:11056819-11056841 ATATGAAAGTGCCTGGAATATGG - Intergenic
1079907821 11:26270578-26270600 ATCTCAAAGCACCAGGAAATAGG + Intergenic
1080716571 11:34807961-34807983 ACTTGAAAGCACTTGGAAAAGGG - Intergenic
1081489129 11:43553763-43553785 AGCTGAAACCTCCTGGAGCAAGG + Intergenic
1081552235 11:44124358-44124380 ATCTGAAAGCGACTGGAAGCTGG - Intronic
1081644375 11:44779333-44779355 ATCTGAAAGCATCTGGCCCCAGG - Intronic
1085348824 11:75785293-75785315 AAATGAGAGCACCTGGCACAGGG + Intronic
1086086151 11:82956914-82956936 AAATGAAAGAACCTGGCACAGGG - Intronic
1086215108 11:84369836-84369858 ATCTGCATGCTCCTGGCACATGG - Intronic
1087283969 11:96244145-96244167 ATTTCAAAACATCTGGAACACGG - Intronic
1087845345 11:102965530-102965552 ATATCAGAGCACCTGGAAAATGG + Intergenic
1088143792 11:106650087-106650109 ATGTGAAAGGAACTGGAACTGGG - Intergenic
1088448015 11:109953037-109953059 ATCTGCCAGCACCTTGAACTTGG - Intergenic
1088482498 11:110308010-110308032 ATCTGCCAGCACCTGGATCTTGG + Intergenic
1090423609 11:126592167-126592189 TTCGGAAAGTACCTAGAACAAGG - Intronic
1090426965 11:126614603-126614625 ATCTGAGATCACCTGCACCAGGG - Intronic
1090987638 11:131785270-131785292 ACCTGAAAGCACCTGAGCCATGG + Intronic
1091975225 12:4819367-4819389 GTTTGAAAGCCACTGGAACAGGG - Intronic
1092571077 12:9721967-9721989 ATCTGAAAGAACTTAGAAAAGGG - Intronic
1093140367 12:15503362-15503384 ATCTGAAAGCAAATGGATAAAGG + Intronic
1095205426 12:39434488-39434510 ATGTGAAAGCACTTGAAAAATGG - Intronic
1095417520 12:41992781-41992803 TTTTTAAAGCACCTGGCACATGG + Intergenic
1096123233 12:49102217-49102239 GTCAGCAAGCACCTGGAACCAGG + Intronic
1096817628 12:54211294-54211316 ATCTGGGAGCACCTGGCCCAGGG + Intergenic
1097849543 12:64397980-64398002 ATCTGTCAGCACCTTGATCATGG - Intergenic
1098613458 12:72491219-72491241 ATATGAAAGCACATGGCATATGG + Intronic
1099037612 12:77608916-77608938 ATCTGGAAGAACCTTGAAAATGG - Intergenic
1100794444 12:98165257-98165279 ATCTGCCAGCACCTGGATCTTGG + Intergenic
1101148539 12:101864246-101864268 ATCTGCAAGCACCTTGATCTTGG + Intergenic
1101852378 12:108414268-108414290 CACTCACAGCACCTGGAACACGG + Intergenic
1101995070 12:109519486-109519508 ATGTGAAAGCAAGTGGCACATGG - Intronic
1102150886 12:110688763-110688785 AACTGAAGGCACCTGGCCCAGGG + Intronic
1102553466 12:113710083-113710105 ATCTGACAGCACCTTGATCTTGG + Intergenic
1103206830 12:119136303-119136325 ATGTGCAAGCACCTGGACTAGGG - Intronic
1103614090 12:122141330-122141352 ACCTGAAGGCACCTGATACAGGG - Intronic
1104993905 12:132642386-132642408 ATGTGAAAGTACCTGCACCAGGG + Exonic
1109590305 13:64471015-64471037 TTCTGCAAGGTCCTGGAACAAGG - Intergenic
1110507282 13:76301676-76301698 AATTAAAAACACCTGGAACATGG - Intergenic
1110691712 13:78437724-78437746 ATCTGATAGGACCTGAAAAATGG - Intergenic
1111073975 13:83208182-83208204 AGATGAAAGCACATGTAACAAGG - Intergenic
1111787581 13:92809574-92809596 ATGTGAATGTACGTGGAACATGG - Intronic
1118130254 14:62955125-62955147 ATGTGAAAGGAACTGGAAAAAGG + Intronic
1118718787 14:68579225-68579247 ATTTGAAAGCAGCTGGACAAAGG - Intronic
1124905474 15:33864127-33864149 ATCAGAAAGAACCTGGAACGAGG - Exonic
1125092974 15:35816401-35816423 ATATGCTAGCACCTGGGACATGG - Intergenic
1125515405 15:40316553-40316575 ATCAGAGAGCACCTGCCACAGGG - Intergenic
1126065858 15:44825782-44825804 ATCTGAAAGAATCGGGCACAAGG + Intergenic
1126093976 15:45074784-45074806 ATCTGAAAGAATCGGGCACAAGG - Exonic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1127118623 15:55751652-55751674 CTTCTAAAGCACCTGGAACAGGG - Intergenic
1128514524 15:68334062-68334084 AGCTGAAGGCACATGGAAAAGGG - Intronic
1129685901 15:77686026-77686048 ATTTGGAAGCAGCTGGAGCATGG + Intronic
1133482919 16:6189056-6189078 ATCTGAAACCACATAAAACATGG - Intronic
1137940628 16:52680287-52680309 ATCTGCCAGCACCTTGAACTTGG - Intergenic
1138118097 16:54376347-54376369 ACCTGTAAAAACCTGGAACAAGG - Intergenic
1138918557 16:61498629-61498651 ATCTGCGAGCACCTGGATCTTGG - Intergenic
1140863811 16:79042075-79042097 AGGTGCAGGCACCTGGAACATGG - Intronic
1142545166 17:696307-696329 ATCTGTAAGCAACTGGCAGAAGG + Intronic
1142835145 17:2580008-2580030 TCCTGAAAGCATCTGGAACCAGG - Intergenic
1143853942 17:9834639-9834661 ATCTGAAAGCAGCCGGAGCCGGG - Intronic
1144246448 17:13370761-13370783 ATTGGAACGCACCTGAAACAAGG + Intergenic
1144600763 17:16610811-16610833 AAATGACAGCAACTGGAACAAGG + Intergenic
1145165869 17:20613049-20613071 ATCTGAGTGCTCCTTGAACACGG + Intergenic
1148603347 17:48909817-48909839 ATCTGAAAGGACGTGGAACATGG - Intronic
1148846188 17:50531567-50531589 ATCTGAGGGCAGGTGGAACATGG - Intergenic
1150541228 17:66102211-66102233 CTCTCAAAGTACCTGGCACATGG - Intronic
1152500731 17:80707212-80707234 TTCTGAAAACATCTGGAGCATGG - Intronic
1158284885 18:55869243-55869265 AACTTCAAGCTCCTGGAACAAGG + Intergenic
1158796070 18:60848137-60848159 ATCTGATAGCAGCTAGCACAGGG + Intergenic
1158951397 18:62498748-62498770 ATCTGACAGCACTTGAAACAAGG + Intergenic
1159643255 18:70888073-70888095 GTATGAAAGCACCTGGAGTAGGG + Intergenic
1162643289 19:12030150-12030172 ATCTGTCAGCACCTTGAACATGG + Intronic
1164503662 19:28840456-28840478 ATATTAAAGCACTTGGCACATGG + Intergenic
1164972216 19:32542377-32542399 ATCTGCCAGCACCTGGATCCTGG + Intergenic
1167426069 19:49430375-49430397 ATTTGACAGCACTGGGAACAAGG + Exonic
926383598 2:12314961-12314983 ATCTGCCAGCACCTTGATCATGG - Intergenic
926611706 2:14954208-14954230 CTGGGAAAACACCTGGAACATGG - Intergenic
926936604 2:18092156-18092178 ATCTGCCAGCACCTTGAACTTGG - Intronic
929275467 2:40020585-40020607 ATGTGAAAGCAACTAGAACTGGG + Intergenic
929326180 2:40614134-40614156 ATCTGCCAGCACCTAGAACCTGG - Intergenic
929446279 2:42003884-42003906 ATCTGCCAGCACCTGGATCTTGG - Intergenic
929791903 2:45029508-45029530 ATCTGAAAGCTCCTGGCAGGTGG - Intergenic
930151463 2:48064357-48064379 AACTGAAAACACCAGGAAAATGG + Intergenic
935129415 2:100250270-100250292 GTGTGAAAGCACCTGGCATATGG - Intergenic
935899301 2:107773464-107773486 ACCAGAACGCACCTGGAAAACGG + Intergenic
938889038 2:135683998-135684020 ATACTCAAGCACCTGGAACAGGG + Intronic
940258769 2:151759383-151759405 ATCTGCCAGCACCTGGATCTTGG + Intergenic
941182264 2:162273783-162273805 ATTTGAATGTACCTGGACCATGG + Exonic
941733271 2:168944032-168944054 ATGTGTAAGCCCCTTGAACAAGG + Intronic
941772272 2:169358020-169358042 AGCTGAAAGCGCATGGTACATGG + Intronic
942458512 2:176153366-176153388 CACTGAAAGCACCTAGCACAGGG - Intronic
943049713 2:182900170-182900192 AGCTGAAGGCACCTGGAGCATGG - Intergenic
943313872 2:186361152-186361174 ATCTGCAGGCACCTGGATCTTGG + Intergenic
944039974 2:195342299-195342321 ATCTGAAATAATCTGGAACAAGG - Intergenic
945270958 2:207939591-207939613 CACAGAAAGCACCTGGCACAGGG - Intronic
945758999 2:213887617-213887639 ATCTGAATTCACCTGAAAAAAGG - Intronic
946553149 2:220824296-220824318 CTCTCAAAGCACTTGAAACAGGG - Intergenic
948566578 2:238891207-238891229 ATCTAAGAGCACCTGGAGCTGGG - Intronic
1169955312 20:11096427-11096449 ATGTGAAAGCAGCTGGCACATGG + Intergenic
1170442793 20:16395592-16395614 ATCTGAAAGCACCAGGAAGGCGG + Intronic
1170512623 20:17094455-17094477 TTATGAAAGCACCTGGAGAAAGG + Intergenic
1170574318 20:17651027-17651049 AGCTGACAGTACCCGGAACACGG + Intronic
1170676336 20:18484572-18484594 ATCTGTAAGCACCTTGATCTTGG + Exonic
1172309735 20:33908340-33908362 AGATGAAAACACCTGGAACCTGG - Intergenic
1173578440 20:44129007-44129029 AGCAGAAAGCACTGGGAACAGGG + Intronic
1173730648 20:45325982-45326004 ATCAGAAGGCACCAGGAACAGGG + Exonic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1173927554 20:46792142-46792164 ATCTGACAGCACCTGTCACCAGG - Intergenic
1174112621 20:48206621-48206643 ATCTGCAGGCACCTTGATCACGG - Intergenic
1177321135 21:19522348-19522370 CTCTGAAATCACTTGGAACATGG + Intergenic
1178723332 21:35029501-35029523 ACCTGAGAGAGCCTGGAACACGG + Intronic
1178974321 21:37208643-37208665 GTATGGAAGCACCTAGAACAGGG - Intergenic
1180622209 22:17169658-17169680 ATCTGAAAGCCTCTGAACCAGGG - Intergenic
1181523819 22:23466726-23466748 CTCTGCAAGCACCTGGATGAAGG + Intergenic
1183120536 22:35727005-35727027 AGCTGGAAGCACCTGGAGGATGG + Exonic
1184118045 22:42433263-42433285 AGCTGGAGGCACCTGGTACATGG + Intergenic
949608134 3:5676554-5676576 ATGTGAAAGAAACTGGAAGAAGG - Intergenic
949871040 3:8589248-8589270 ATTAGAAATTACCTGGAACAGGG + Intergenic
951104396 3:18726139-18726161 ATCTTCAGGCACCAGGAACAAGG + Intergenic
951177527 3:19618902-19618924 CTGTGAAAGCAGCTGGGACAGGG - Intergenic
951337987 3:21447394-21447416 CTCTGAAAGCTCTTGGAACAGGG - Intronic
956052661 3:65265289-65265311 ATCACAAAGCACCTGCCACATGG + Intergenic
956432545 3:69201788-69201810 CTCAGACAGCACCTGGCACAGGG + Intronic
957251317 3:77774343-77774365 CTCTGATAGCACCTTGAATAAGG - Intergenic
958763158 3:98332430-98332452 AAATGAAATCACCTGGAAAATGG + Intergenic
959293829 3:104510346-104510368 TGCTGAATGCACTTGGAACAAGG + Intergenic
959459642 3:106609320-106609342 GCCTCAAAGCAACTGGAACATGG + Intergenic
961779713 3:129314590-129314612 AACTTAAAGTACCTGGGACAGGG - Intergenic
962514307 3:136135687-136135709 ATATGTAAACACCTGGCACATGG + Intronic
964787049 3:160408445-160408467 ATCTTAAAGCATATGAAACAAGG - Intronic
965733871 3:171800747-171800769 ATCTGCAAGCACCTTGATCTTGG - Intronic
966083936 3:176043569-176043591 ATCTGACAGCACCTTGATCTTGG - Intergenic
966696107 3:182792678-182792700 ATATACAAGCAACTGGAACAAGG - Intergenic
966955071 3:184868300-184868322 ATGTAAAAGCACCTGGAGCTAGG + Intronic
967336642 3:188351576-188351598 ATGTGAAAACACCTGTCACAAGG - Intronic
967559809 3:190904849-190904871 ATGTGGAAGCAACTGGAACTGGG + Intergenic
968111703 3:196053681-196053703 CTCCGAAAGCACCTTGCACAGGG + Intronic
970880230 4:20919768-20919790 ATGAGAAAGCAGCTGGTACATGG + Intronic
973558514 4:52110219-52110241 ATCTGCCAGCACCTGGATCTTGG + Intergenic
974511120 4:62842111-62842133 ATCTGAAAGTACCTTGATAATGG + Intergenic
974604073 4:64126383-64126405 ATCTGACAGCACCCTGAACTTGG + Intergenic
975169378 4:71215548-71215570 ATGTGAAAGTGCCTGGCACAGGG - Intronic
975979251 4:80137626-80137648 ATCTGAAACAACCAGGAAGAAGG - Intergenic
976217003 4:82724877-82724899 CTCTGAGAGCAAATGGAACATGG + Intronic
976579656 4:86721355-86721377 ATCTGAAAGCACCTAGTACATGG - Intronic
976669286 4:87634202-87634224 ATGTTAAAGCACATGGAACTTGG - Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977188229 4:93967365-93967387 ATTTAAAAGCACCTGGGGCAGGG - Intergenic
979274329 4:118798579-118798601 CTCTGCAAGCACCTAGGACAGGG - Intronic
979797202 4:124861164-124861186 ATCTGCAAGCACCTTGACCTTGG - Intergenic
980117881 4:128697343-128697365 AGCAGAAAGGACCTGGAAGACGG + Intergenic
980279577 4:130702589-130702611 AACTTAAAGCACCTGGGTCAAGG + Intergenic
980721651 4:136705189-136705211 ATCTGCAAGCTCCAGGAAGAGGG - Intergenic
981330414 4:143502124-143502146 ATCTGCCAGCACCTGGATCTTGG - Intergenic
982703449 4:158682373-158682395 CTTTAAAAGCACCTGGATCAAGG - Exonic
982912742 4:161165346-161165368 ATCTGCCAGCACCTTGAACTTGG - Intergenic
983873075 4:172844182-172844204 GTCAGAAAGCACGTTGAACATGG - Intronic
985376268 4:189342591-189342613 CTAGGATAGCACCTGGAACATGG - Intergenic
986882073 5:12186290-12186312 ATCTGATAGCACCTTGATCCAGG + Intergenic
988441319 5:31236879-31236901 ATCTGAAATCACATCGAATAAGG - Intronic
988893309 5:35643755-35643777 TTCATAAAGCACCTGAAACAGGG - Intronic
990808961 5:59700756-59700778 ATCTGAATGCAACTGGAGAAGGG - Intronic
992073243 5:73167966-73167988 ATCTGATGGCAGCTGGATCATGG - Intergenic
993879434 5:93345686-93345708 ACCAGAAAGCACCAGGAAGACGG - Intergenic
995597148 5:113759892-113759914 ATCTGATAGCACGTGGAGGATGG + Intergenic
996152243 5:120053414-120053436 ATGTGAAAGTTCCAGGAACATGG - Intergenic
998737762 5:145162293-145162315 CTCTGAAAGCACATGAAACTGGG - Intergenic
999055756 5:148574341-148574363 ATCTGAAAACACCTGATAAAAGG + Intronic
999472444 5:151867308-151867330 ATCTGGTTTCACCTGGAACAAGG + Intronic
1000366436 5:160495560-160495582 TTCTGAAATCAACTGGACCATGG + Intergenic
1001850397 5:174959099-174959121 ATTTGAATGTACCTGGACCATGG + Intergenic
1003413037 6:5882596-5882618 CTATGAAAGCACCTAGAACATGG - Intergenic
1006614594 6:35317880-35317902 GTCTGGCAGCACCTGGCACAGGG - Exonic
1006852214 6:37107095-37107117 ATCTGAGAACACCTCGAACAAGG - Intergenic
1007014297 6:38448199-38448221 ACCTGAAAGTACCTGGAATGAGG + Intronic
1007638904 6:43320213-43320235 ATCTGTAAGCACCTTGATCTTGG + Intronic
1008077100 6:47156397-47156419 GTCAGATAGCACCTGGCACAAGG - Intergenic
1008679042 6:53852957-53852979 ATCTGCCAGCACCTGGATCTTGG - Intronic
1008959404 6:57250711-57250733 TACTGAAAGCAACTGGAACTTGG + Intergenic
1009037872 6:58139973-58139995 ATCTGAAATCACCTGAAAGAGGG - Intergenic
1009213660 6:60893609-60893631 ATCTGAAATCACATGAAAGAGGG - Intergenic
1009333319 6:62453760-62453782 ATCTGACAGCACCTCGATCTTGG - Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012796228 6:103765579-103765601 ATCTAACAGCAACTGGAACTCGG + Intergenic
1014716082 6:124865792-124865814 ATCTGCCAGCACCTGGGACATGG + Intergenic
1014990582 6:128070428-128070450 ATCCGAGAGCACCTGGATCTTGG + Intronic
1015416471 6:132954496-132954518 ATCTGGAGGCAACAGGAACATGG + Intergenic
1015496046 6:133884448-133884470 AGCTGAAAGCACCTGCCACCAGG + Intergenic
1016440159 6:144075149-144075171 ACCTGAAAGCCCTTGGAAAAGGG - Intergenic
1016507100 6:144794750-144794772 ATCTGCTAGCACCTTGATCATGG - Intronic
1017592645 6:155993720-155993742 ATCGGAAAGGACAGGGAACAGGG - Intergenic
1017684913 6:156902919-156902941 CTCTGAAAGCCCCTTGAAAAAGG - Intronic
1019916672 7:4137538-4137560 TTCTGAATACACCTGGAAGACGG - Intronic
1021061707 7:16120326-16120348 ATGAGATAGCACCTGGAAGATGG - Intronic
1021928482 7:25556017-25556039 CTCTGAAAGAACCAAGAACATGG - Intergenic
1022596947 7:31721866-31721888 TGGTGAAAGCACCTGGTACAGGG - Intergenic
1022598440 7:31734444-31734466 ATATGAAAGCCCCTGCACCAAGG + Intergenic
1022714400 7:32885594-32885616 ATCTGGAAGCACCTGATACCAGG - Intronic
1026315852 7:69226609-69226631 ATCTGACAGCACCTTGAACTTGG - Intergenic
1026491361 7:70866613-70866635 ATCTGCAAGCACCTTGATCTTGG - Intergenic
1027770659 7:82402288-82402310 GTGTGAAAGTATCTGGAACATGG - Intronic
1029277201 7:99413545-99413567 ATCTGAAAGCATAGGGACCAAGG + Intronic
1030147190 7:106368600-106368622 TTCTCAAAGCTCCTTGAACATGG - Intergenic
1031624825 7:123980333-123980355 ATCTCAAAGCACCTTGATCTTGG - Intergenic
1032859096 7:135860885-135860907 ATCTGACAGCACCTGGATCTTGG - Intergenic
1034419861 7:150984283-150984305 CTCTGAAAGCACATGAGACATGG - Intergenic
1034973148 7:155431646-155431668 ATCTTAAAGCTCCTCTAACATGG - Intergenic
1035745085 8:1956037-1956059 ATCTGAAAGCACTTGGGGAAAGG + Intronic
1036119423 8:5999597-5999619 ATCTGTTAGCACCTCGAACTTGG + Intergenic
1036436080 8:8734656-8734678 ATCTGCCAGCACCTGGATCTTGG + Intergenic
1037092702 8:14942770-14942792 ATATCAAAGCACCTGAAAGAGGG - Intronic
1037533665 8:19804928-19804950 ATTAGACAGCACCTTGAACAAGG + Intergenic
1037829459 8:22179224-22179246 ATCTGAAAGCACCTGGAACAAGG - Intronic
1037867386 8:22456884-22456906 ATCTGAAAGCAGCTGACACATGG + Intronic
1038218580 8:25586043-25586065 AGCTGAAAGCAACTGGGAAAAGG + Intergenic
1041374821 8:57203004-57203026 GTCTGAAAGCATCTGGAGAAGGG + Intergenic
1041967963 8:63702180-63702202 TTCTGAAAGCAAGTGGAACCTGG - Intergenic
1042539017 8:69888876-69888898 ATTTGAAAGTTCCTGAAACATGG - Intergenic
1042938769 8:74086881-74086903 ATCTGCAGGCACCTTGAACTTGG + Intergenic
1046914879 8:119669343-119669365 ATGTGAATGCACCTGAAACATGG - Intronic
1047175366 8:122535776-122535798 ATCTGAAGGCACCTTGATCTGGG - Intergenic
1048542975 8:135359683-135359705 ATTTGAAAGCATCTAGCACAGGG + Intergenic
1048658174 8:136566649-136566671 CTCTGAAGGCAACTGGTACAGGG - Intergenic
1048715344 8:137262654-137262676 ATCTGAAAGCAGTTGGAAAATGG + Intergenic
1049515611 8:143053355-143053377 CTCTAAAAGCACCTAGAGCACGG - Exonic
1052414025 9:28155109-28155131 ATATGCAAGCAACTGGCACATGG + Intronic
1053008606 9:34620963-34620985 CTCTGAAAGCCCCTGGCCCAAGG + Intergenic
1054887717 9:70216956-70216978 ATGTGAAATCACCTGGAGCTCGG + Intronic
1055096395 9:72418841-72418863 ATCTGAAAGCAGCTTGCAGAAGG + Intergenic
1055097859 9:72432879-72432901 TTGTGAAAGCAGCTGGCACATGG - Intergenic
1055642657 9:78332429-78332451 ATCTGAAAGCTTTTGGAAAATGG + Intergenic
1056565317 9:87766924-87766946 ATCTGACATCACCTGGAGGATGG + Intergenic
1056667139 9:88589875-88589897 CCCTGAAAGCATCTAGAACAGGG - Intergenic
1056743165 9:89277488-89277510 AGCTCATAGCAACTGGAACATGG - Intergenic
1057039723 9:91839224-91839246 ATCTGACAGCACCAGGAATCAGG - Intronic
1058220526 9:102294813-102294835 GTCTGAAAGCATCAGAAACAGGG - Intergenic
1058900266 9:109436096-109436118 ATATGAAAGCATCTGGATAAAGG + Intronic
1059351529 9:113668837-113668859 CTCTGAATGCCCCTGGCACATGG + Intergenic
1059492097 9:114676525-114676547 ACCTAACAGTACCTGGAACATGG - Intergenic
1059636711 9:116178680-116178702 ATGTGACAGCACTTGGCACATGG - Intronic
1062505688 9:136874567-136874589 TTCTGAAAGCATTTGGAATAAGG + Intronic
1186479179 X:9883148-9883170 AGCTGCAAGCTCCTGGAAGACGG - Intronic
1186938361 X:14475987-14476009 TTCTGAAAGCCACTGGTACAGGG - Intergenic
1187295111 X:17991844-17991866 ATCTAAAAGTGCCTGGCACAAGG - Intergenic
1187370099 X:18698129-18698151 ATTTAAAAGTACCTAGAACATGG + Intronic
1187814040 X:23211576-23211598 ATCTGAAAGCCTATGAAACAAGG + Intergenic
1191054847 X:56231446-56231468 ATGTAAAAGCACCTGGCTCAGGG + Intergenic
1192580807 X:72279374-72279396 ATCTGAGAGCACTGGGAAGATGG + Intronic
1193550717 X:82889154-82889176 ATCTGCTGGCACCTGGAACTTGG + Intergenic
1194740283 X:97564400-97564422 ATCTGACAGCACCTTGATCCTGG - Intronic
1194971192 X:100346140-100346162 GTTTGAAAACACCTAGAACAGGG + Intronic
1195466518 X:105184975-105184997 ACCTGAAAGTACTTAGAACAGGG - Intronic
1195591655 X:106635195-106635217 ATCTATAAGCATCTGGTACATGG - Intronic
1196487945 X:116235501-116235523 ATATGAAAGCACCTACCACAGGG - Intergenic
1196981492 X:121219032-121219054 AACTGAAATCAGCTGGAAAAGGG + Intergenic
1197812119 X:130454241-130454263 ATCTGAAAACTCCTTTAACACGG + Intergenic
1199433291 X:147784945-147784967 ATGTGAAAGCATCTAGTACAAGG + Intergenic
1199686068 X:150266763-150266785 TTCTGAAAGCACTTTGAACAGGG - Intergenic
1199724113 X:150565350-150565372 AGCAGAAAGCACTTGGAACTAGG - Intergenic
1200753703 Y:6970229-6970251 ATGTGAAAGCGCTTAGAACATGG + Intronic
1202097202 Y:21264098-21264120 CTCTCAGTGCACCTGGAACATGG - Intergenic