ID: 1037835668

View in Genome Browser
Species Human (GRCh38)
Location 8:22213537-22213559
Sequence CATGAGCTCTGCCACGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037835663_1037835668 -10 Left 1037835663 8:22213524-22213546 CCCACCCACTTGGCATGAGCTCT No data
Right 1037835668 8:22213537-22213559 CATGAGCTCTGCCACGGAGTTGG No data
1037835661_1037835668 0 Left 1037835661 8:22213514-22213536 CCAGACACTGCCCACCCACTTGG No data
Right 1037835668 8:22213537-22213559 CATGAGCTCTGCCACGGAGTTGG No data
1037835659_1037835668 14 Left 1037835659 8:22213500-22213522 CCTGGGCATCTCACCCAGACACT No data
Right 1037835668 8:22213537-22213559 CATGAGCTCTGCCACGGAGTTGG No data
1037835660_1037835668 1 Left 1037835660 8:22213513-22213535 CCCAGACACTGCCCACCCACTTG No data
Right 1037835668 8:22213537-22213559 CATGAGCTCTGCCACGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037835668 Original CRISPR CATGAGCTCTGCCACGGAGT TGG Intergenic
No off target data available for this crispr