ID: 1037838859

View in Genome Browser
Species Human (GRCh38)
Location 8:22230273-22230295
Sequence TGGGCTGCCTCCGAGCGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037838859_1037838866 19 Left 1037838859 8:22230273-22230295 CCCACACGCTCGGAGGCAGCCCA 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1037838866 8:22230315-22230337 CACCTATTCCTGCCTCTCCTTGG No data
1037838859_1037838862 -4 Left 1037838859 8:22230273-22230295 CCCACACGCTCGGAGGCAGCCCA 0: 1
1: 0
2: 0
3: 4
4: 117
Right 1037838862 8:22230292-22230314 CCCACACTCGTCCCATGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037838859 Original CRISPR TGGGCTGCCTCCGAGCGTGT GGG (reversed) Intronic
900142390 1:1144168-1144190 TGGGCAGCCGCCGAGGGTGATGG - Intergenic
902626193 1:17677803-17677825 AGGTCTGCCTCCGGGCCTGTGGG + Intronic
911228197 1:95331536-95331558 TGGGCTTCCTCACAGCATGTTGG + Intergenic
912412982 1:109490702-109490724 TGGGCTGCCTCCTAGTTAGTAGG + Intronic
913270844 1:117091843-117091865 TCTGCTGCCTCCGAGTGTCTAGG - Exonic
917519312 1:175734845-175734867 TGGGCTGCGTGTGAGCGAGTGGG + Intronic
920692654 1:208158827-208158849 TGAGCTGCCTCTGACCCTGTCGG + Intronic
922933545 1:229407933-229407955 TCGCCCGCCTCTGAGCGTGTGGG - Intergenic
1062890609 10:1056928-1056950 TGGGCTGGCTCCGGGGGTGGCGG + Intronic
1066106501 10:32161663-32161685 TGGGCTCCCTCCGAATGTTTCGG + Intergenic
1070800912 10:79243790-79243812 TGGGCTCCCTCCGGGCGCGGGGG + Intronic
1073249743 10:102114376-102114398 TGGGCACCCTGCGAGCCTGTTGG - Intronic
1077285048 11:1761888-1761910 TGGGCTGCCTCAGAGCACTTTGG - Intronic
1077358511 11:2129557-2129579 TGGGGTGCCTCGAAGCGTTTTGG + Intronic
1077490697 11:2859563-2859585 AGGGCTGCCTCTGAGCCTGCGGG - Intergenic
1078139090 11:8678987-8679009 TGGGCTTCCTCAGAGTGTGAGGG - Intergenic
1078571108 11:12458680-12458702 TGGGCTGCCACAGAGGGGGTAGG - Intronic
1080210601 11:29780995-29781017 TGGGCTGACTCTGAGGGGGTAGG - Intergenic
1083322095 11:61854113-61854135 TGGGCTGCGGCCAAGGGTGTGGG - Intronic
1084900376 11:72305636-72305658 TGCACTGCCTCCGAGGGTGGTGG + Intronic
1086972708 11:93100637-93100659 TGTTCTGCCTCCCAGAGTGTTGG - Intergenic
1088355891 11:108943440-108943462 CGGGCTGCCTCTGAGAGAGTGGG + Intergenic
1091384892 12:87285-87307 TGGGCTTCCTCCCAGCATGAAGG + Intronic
1092193117 12:6534297-6534319 TGGGCACGCACCGAGCGTGTGGG - Exonic
1096993330 12:55822451-55822473 TGGGCTGGATGCCAGCGTGTAGG - Exonic
1097188931 12:57210359-57210381 TGGGCTGCCTCCGTGCATTGAGG - Exonic
1103507904 12:121453914-121453936 TGGGCAGGGTCCGAGCCTGTGGG - Intronic
1110344784 13:74432974-74432996 TCGGCTGCCTTTGAGCTTGTGGG + Intergenic
1118361669 14:65062381-65062403 TGGGGTGCCGCCCAGCGTGCTGG + Exonic
1119689294 14:76658285-76658307 TGGGCTGCCTCAGGGCATTTTGG - Intergenic
1122441224 14:101733412-101733434 TGGGCTTCCTCCTAGCATGGCGG + Intergenic
1131811824 15:96180800-96180822 TGTGCTGCCCACAAGCGTGTTGG - Intergenic
1132343143 15:101090612-101090634 TGGGCTTCCTCAGAGCATGGCGG - Intergenic
1133209921 16:4257844-4257866 TGGGGTGTCGCAGAGCGTGTGGG - Exonic
1134011593 16:10857700-10857722 TGGGCGGCCTCCCAAAGTGTTGG - Intergenic
1135203912 16:20465710-20465732 TGGGCTGCATTCGAGCAGGTTGG + Exonic
1135215093 16:20559232-20559254 TGGGCTGCATTCGAGCAGGTTGG - Exonic
1136318754 16:29468918-29468940 TGGGCTGGCTCCCAGGGTGATGG + Intergenic
1136433326 16:30208262-30208284 TGGGCTGGCTCCCAGGGTGATGG + Intronic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1136791050 16:32968450-32968472 TGGGCTTCCCCCGAGCGGTTGGG + Intergenic
1136878763 16:33885482-33885504 TGGGCTTCCCCCGAGCGGTTGGG - Intergenic
1138553816 16:57760913-57760935 TTGGCTGGCTCGGAGCGCGTGGG - Exonic
1139704521 16:68732136-68732158 TGGGCTGCCTGCCAGCATGGAGG - Intergenic
1141839232 16:86564035-86564057 TGGGCGGACTCCGTGGGTGTTGG - Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1142864740 17:2783889-2783911 TGGGCTTCCTCCCAGCATGGTGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147645184 17:42028998-42029020 TGGGCTGGCTCCCTGCATGTAGG + Exonic
1150699697 17:67436251-67436273 TCAGCTGCCTCCCAGAGTGTTGG + Intronic
1156856439 18:41787133-41787155 TGGGCTGTCTCAGAAAGTGTAGG + Intergenic
1165734118 19:38164883-38164905 TGGGCTGCCTCGGTGGGTCTCGG - Exonic
927093617 2:19731130-19731152 TGGACTGCCTCCGTGCCTGGTGG + Intergenic
930661034 2:54053403-54053425 TGGGCTGCCACTGAGGGTGCTGG - Intronic
932699730 2:73984738-73984760 TGGGCGGCCTGCGAGCGGCTTGG - Intergenic
934989891 2:98913737-98913759 TGGGGAGGCTCAGAGCGTGTAGG - Intronic
937113426 2:119385196-119385218 TGGGCTTCCTCAGAGCATGGTGG + Intergenic
940090027 2:149904538-149904560 TGGGCTGCCTCCCAGCATGCTGG - Intergenic
942206222 2:173622158-173622180 TGGGCTTCCTCAGAGCATGGTGG - Intergenic
944918787 2:204389114-204389136 TGGGCTGCCTGGGAGCTTCTAGG + Intergenic
944923519 2:204439286-204439308 TGGACTGCCTCCCAGCATGGTGG + Intergenic
948329037 2:237150673-237150695 TGGGCTGTGTCCGTGCATGTGGG + Intergenic
948839302 2:240641343-240641365 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839313 2:240641382-240641404 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839324 2:240641421-240641443 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839335 2:240641460-240641482 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839346 2:240641499-240641521 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839357 2:240641538-240641560 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839368 2:240641577-240641599 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839379 2:240641616-240641638 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839390 2:240641655-240641677 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839401 2:240641694-240641716 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839412 2:240641733-240641755 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839423 2:240641772-240641794 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839434 2:240641811-240641833 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
948839445 2:240641850-240641872 TGGGCCCCGACCGAGCGTGTAGG - Intergenic
1168810732 20:702936-702958 TGGGCTTCCTCCTAGCATGCAGG - Intergenic
1169195824 20:3681618-3681640 TGGGCTGCCCCCGAGGGGGAGGG + Intronic
1170031678 20:11950410-11950432 TGGGCTTCCTCCAAGCATGGCGG - Intergenic
1174085261 20:48003616-48003638 TGGGCTTCCTCCTAGCATGGCGG - Intergenic
1174597868 20:51698890-51698912 TGGGCTCCCTCACAGGGTGTGGG - Intronic
1174738110 20:52984629-52984651 TGGGGTGCCTCGGAGGGTGCAGG + Intronic
1174786290 20:53436389-53436411 TGGGCAGCCTCTGAGCTTCTGGG - Intronic
1175277245 20:57780628-57780650 TGTGCTGCCTCTGAGGGTGCAGG + Intergenic
1179707987 21:43193633-43193655 TGGGCTGCATGGCAGCGTGTGGG + Intergenic
1182772469 22:32805193-32805215 GGGCCTGCCTCTGAGCCTGTTGG + Intronic
1182985289 22:34710542-34710564 TGGGCTTCCTCAGAGCATGGTGG - Intergenic
1184596569 22:45517515-45517537 TGGCCTGGCTCTGAGGGTGTGGG + Intronic
949573972 3:5320789-5320811 TGGGCTTCCTCCCAGCATGGTGG + Intergenic
954391736 3:50271160-50271182 CGGGCTGCCTCCGTGCTGGTGGG + Exonic
961091127 3:124113688-124113710 TGGGCTGCCTCAGAGGGGGCAGG + Intronic
966591496 3:181688538-181688560 TGGGCTGCCTGCAAGGGTGATGG + Intergenic
969532561 4:7737962-7737984 TGGGCTTCCTCCCAGCATGGCGG + Intronic
986025029 5:3842771-3842793 TGGGCTGTCCCCGAGAGTCTGGG - Intergenic
989117476 5:37969323-37969345 TGGGCTTCCTCAGAGCATGGTGG + Intergenic
989118212 5:37977404-37977426 AGGGCTGCCTCAGAGGGTCTTGG + Intergenic
990136571 5:52652122-52652144 TCTGCTGCCTCAGAGCATGTTGG + Intergenic
990210866 5:53480548-53480570 TGGGCGGTCTCCCAGTGTGTGGG - Exonic
1008878039 6:56350827-56350849 TGGGCTGAGTCCTAGGGTGTGGG - Intronic
1015170752 6:130249907-130249929 TGGACTTCCTCAGAGCGTGTGGG - Intronic
1015410207 6:132885778-132885800 TGGGCTTCCTAGGAGCGTGGTGG + Intergenic
1017986240 6:159445412-159445434 TGGGCTTCCTCCCAGCATGGTGG - Intergenic
1018094112 6:160370045-160370067 TGGGCTTCCTCCTAGCATGGTGG + Intronic
1019348276 7:541212-541234 TGGGCTTCCTCCCAGCATGGTGG - Intergenic
1019362763 7:613955-613977 AGGGCTGCCACCAAGCGGGTGGG + Intronic
1019971295 7:4543014-4543036 TGGGCTTCCTCAGAGCATGGTGG + Intergenic
1035240705 7:157527430-157527452 TGGGCTGGCTTCGTGCGTGAGGG + Intergenic
1037808956 8:22074816-22074838 TGGGCTTCCTCAGAGCTTGGCGG + Intronic
1037838859 8:22230273-22230295 TGGGCTGCCTCCGAGCGTGTGGG - Intronic
1044934411 8:97279006-97279028 AGGGCTGCCTCCGGGACTGTGGG - Intergenic
1048910611 8:139131277-139131299 TGGGCTGCCTCCGGGCCACTTGG - Intergenic
1049508884 8:143018104-143018126 AGGGGTGCCTCGGAGAGTGTCGG - Intronic
1049573538 8:143380360-143380382 TGGGCAGCCTCTGAGCAGGTGGG + Intronic
1049577025 8:143394226-143394248 AGGGCTGACCCAGAGCGTGTGGG + Intergenic
1051557315 9:18399106-18399128 TGGGGAGCCTACGAGCTTGTGGG + Intergenic
1055623511 9:78149982-78150004 TGGGCTGCCTCCCATGGTGTGGG - Intergenic
1056533614 9:87508835-87508857 TGGGCTGCCTCAGAGAGGATAGG + Intronic
1057503090 9:95611264-95611286 TGGGCTGCCACGGTGTGTGTGGG + Intergenic
1060977595 9:127774143-127774165 TTGGCTGCCTCCAAGCCTGGGGG + Exonic
1061290456 9:129647788-129647810 TGGGGTGCATGTGAGCGTGTGGG - Intergenic
1061795084 9:133081666-133081688 GGAGCTGCCACCGAGCGTCTCGG + Intronic
1062662619 9:137646543-137646565 GGGGAGGCCCCCGAGCGTGTGGG + Intronic