ID: 1037840963

View in Genome Browser
Species Human (GRCh38)
Location 8:22245099-22245121
Sequence GCGCCAAGATGGCGGCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 1, 2: 2, 3: 5, 4: 113}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037840949_1037840963 10 Left 1037840949 8:22245066-22245088 CCAGTCCCGCCCCCCTAACGTCA 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840956_1037840963 -3 Left 1037840956 8:22245079-22245101 CCTAACGTCACTTCCGCCCCGCG 0: 1
1: 0
2: 1
3: 4
4: 22
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840951_1037840963 4 Left 1037840951 8:22245072-22245094 CCGCCCCCCTAACGTCACTTCCG 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840954_1037840963 -1 Left 1037840954 8:22245077-22245099 CCCCTAACGTCACTTCCGCCCCG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840952_1037840963 1 Left 1037840952 8:22245075-22245097 CCCCCCTAACGTCACTTCCGCCC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840948_1037840963 11 Left 1037840948 8:22245065-22245087 CCCAGTCCCGCCCCCCTAACGTC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840955_1037840963 -2 Left 1037840955 8:22245078-22245100 CCCTAACGTCACTTCCGCCCCGC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840950_1037840963 5 Left 1037840950 8:22245071-22245093 CCCGCCCCCCTAACGTCACTTCC 0: 1
1: 0
2: 1
3: 7
4: 139
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840947_1037840963 28 Left 1037840947 8:22245048-22245070 CCTGATAAATACTGTGGCCCAGT 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113
1037840953_1037840963 0 Left 1037840953 8:22245076-22245098 CCCCCTAACGTCACTTCCGCCCC 0: 1
1: 0
2: 1
3: 4
4: 84
Right 1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG 0: 1
1: 1
2: 2
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037840963 Original CRISPR GCGCCAAGATGGCGGCGCCC AGG Intronic
900313244 1:2044828-2044850 GCGCCAAGCAGGAAGCGCCCCGG + Intergenic
900964256 1:5946850-5946872 GTGCCCAGAGGGCGGTGCCCAGG + Intronic
901439164 1:9267182-9267204 GCGCCAGGAGGGCGGCTTCCTGG - Exonic
902067463 1:13700199-13700221 GAGTCAAGATGGCGGCGGCGCGG + Intronic
902323807 1:15684991-15685013 CCGCCAGGCTGGCGTCGCCCAGG + Intronic
902488616 1:16764474-16764496 GCGCCATGATGGCTGTGCCTGGG + Intronic
903888868 1:26556750-26556772 TGGCCAAGATGGCTGAGCCCTGG - Intronic
904267386 1:29325650-29325672 GAGTCAAGATAGCGGGGCCCTGG + Exonic
905366776 1:37456026-37456048 AGGCCAAGATGGCGGCGACAAGG + Intergenic
907397295 1:54200194-54200216 GCGGCAACATGGCGGGGTCCAGG + Exonic
907540999 1:55215339-55215361 AGGCCAACATGGCGGCGCGCAGG - Intergenic
908193285 1:61725106-61725128 TCTCCAAGATGGCGGCCGCCTGG - Exonic
910292823 1:85616024-85616046 GCGCCAGGCTGGCGGCGCAGCGG - Intergenic
915214178 1:154329028-154329050 GCTCCAAGAGGGAGGCGCCTGGG - Intronic
923151919 1:231241218-231241240 TGGCTGAGATGGCGGCGCCCGGG + Exonic
923506544 1:234609992-234610014 GCGCCGGGGTGGCGGCGGCCGGG + Intergenic
923531823 1:234818042-234818064 GCGCCATGATGGCTGTGCCTGGG - Intergenic
924112174 1:240711124-240711146 GTGCCATGATGGAGGCGCTCAGG - Intergenic
1067211146 10:44261168-44261190 GTGCCAAGATGGGGGCCCCAAGG - Intergenic
1073252911 10:102133061-102133083 GGGCCAAGATGGCGGCGCGCCGG + Exonic
1075780940 10:125016678-125016700 GGGCCAAGAGCGCTGCGCCCAGG + Intronic
1078335804 11:10462413-10462435 GAGCCAAGGTGGAGTCGCCCTGG + Intronic
1080633629 11:34104578-34104600 GCTCCAAGATGGGGGAGTCCTGG - Intergenic
1080728027 11:34916648-34916670 CCGTCAAGATGGCGGCCTCCTGG + Exonic
1084170890 11:67400557-67400579 GCTCCACGAAGGCGGGGCCCAGG - Intronic
1088220518 11:107565708-107565730 TCTCCAACATGGCCGCGCCCAGG - Exonic
1092282438 12:7108415-7108437 GGGCCAAGAGGACGGAGCCCCGG + Exonic
1092462356 12:8697862-8697884 GCGCCAGGAGGGCGGGGCCGGGG + Intronic
1095703686 12:45216270-45216292 GCGCGAAGTTGGGGGCTCCCGGG - Exonic
1095945938 12:47753450-47753472 GTGCCAAGATGCCTGTGCCCAGG - Intronic
1101090481 12:101280122-101280144 TCTCCAACATGGCGGCGCCCAGG + Exonic
1101870618 12:108562615-108562637 CCGGCAAGATGGCGGCGGCTGGG + Exonic
1102592345 12:113966299-113966321 CGGTAAAGATGGCGGCGCCCAGG - Exonic
1103385503 12:120529127-120529149 CTACCAAGATGGCGGCCCCCGGG - Exonic
1103763361 12:123266426-123266448 TCGCCAAGTGGGCGGCTCCCCGG - Intronic
1103775661 12:123364821-123364843 GCGTCAAGATGGCGGCGGGGAGG - Intronic
1103951662 12:124554740-124554762 GCGGCAAGGGGGCAGCGCCCAGG + Intronic
1105725708 13:23160320-23160342 GCGTCCAGCCGGCGGCGCCCTGG + Intergenic
1119106755 14:71932328-71932350 GGGCCCAGGTGCCGGCGCCCAGG + Intergenic
1122183442 14:99971807-99971829 CCGCCAAGATGGCAGGGGCCGGG + Intronic
1122672842 14:103385397-103385419 GAGCCAAGATGGCCGCCCCTCGG - Intronic
1122788267 14:104173815-104173837 GGGCCAAGATGACGCTGCCCAGG - Exonic
1125379807 15:39075660-39075682 ATGCCAAGATGCCGGCCCCCAGG + Intergenic
1129408504 15:75336066-75336088 GCGCCAAGAAGCCAGGGCCCGGG - Exonic
1130115843 15:81003218-81003240 GCGCCAAGATGTCGGACCACAGG + Exonic
1132572264 16:649284-649306 CCGCCGTCATGGCGGCGCCCTGG - Intronic
1132869489 16:2109461-2109483 GCAGCAAGGTGGTGGCGCCCGGG - Exonic
1134717927 16:16366138-16366160 GCAGCAAGGTGGTGGCGCCCGGG + Intergenic
1134956824 16:18386021-18386043 GCAGCAAGGTGGTGGCGCCCGGG - Intergenic
1135557947 16:23452902-23452924 GCTCCAAGGAGGCGGCGTCCGGG - Exonic
1139631744 16:68235666-68235688 GCGCCAGGCTGTCGGCGCTCAGG + Exonic
1141430606 16:83968752-83968774 GCGCCAGGATGGGCGAGCCCCGG + Exonic
1141538486 16:84700016-84700038 GCGAGAAGATGGCGGCGGCGGGG + Exonic
1144862667 17:18315298-18315320 ATGTCAAGATGGCGGCGCCGCGG + Exonic
1146370981 17:32265712-32265734 GGGCCCGGGTGGCGGCGCCCGGG + Intergenic
1147920450 17:43913559-43913581 GAGCCATGATGGGGGAGCCCTGG + Intergenic
1151729875 17:75904861-75904883 GAGGGAAGATGGCGGCGCCCTGG - Exonic
1152354117 17:79798355-79798377 GCGCGAAGATGGCGGGCTCCTGG + Intronic
1158492796 18:57925384-57925406 GCGCCCAGGTGGAGGCTCCCAGG + Intergenic
1162435292 19:10654492-10654514 GCGTCAATGTGGCGGCGGCCGGG + Intronic
1162724529 19:12681941-12681963 GCACAAAAATGGCGGCGACCTGG - Intergenic
1162796327 19:13089442-13089464 GCCCCAGGATGGCTGCTCCCAGG + Intronic
1162802063 19:13116711-13116733 GTGCCAACATGGCGGCGCCCAGG - Exonic
1164952112 19:32345621-32345643 GCTCCAAAATGGCGGCGCTGGGG - Exonic
1167924131 19:52809889-52809911 GGCACAAGATGGCGCCGCCCCGG - Intronic
926940041 2:18126032-18126054 TCTCCAAGATGGCAGCCCCCAGG - Intronic
933750638 2:85600456-85600478 GAGCCAAAATGGGGGCCCCCCGG - Intronic
941987335 2:171522439-171522461 GCCCCAAGAAGTCGACGCCCCGG + Exonic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
948387870 2:237592818-237592840 GGGGCAAGGTGGCGGCGTCCGGG + Intronic
1168991997 20:2103013-2103035 GCGCCAGGAAGGCCTCGCCCGGG - Exonic
1169745380 20:8937258-8937280 GCGCCAAGATGGCTGCCTCAAGG - Intronic
1170998622 20:21391537-21391559 GCGGGATGGTGGCGGCGCCCGGG + Intergenic
1174216730 20:48921728-48921750 GCTCCAACATGGCGGCGCCGTGG + Intergenic
1174494697 20:50931231-50931253 GGCACAAGATGGCGGCGGCCGGG + Exonic
1175447283 20:59032068-59032090 CCGCCAAGATGGCGTCGCTGTGG - Intronic
1175815312 20:61880530-61880552 GCCCCAAGATGACGGCTCCTTGG - Intronic
1177356721 21:20018389-20018411 GAGCCAAGCTGGAGGAGCCCTGG - Intergenic
1180216054 21:46324438-46324460 GATTCAAGATGGCGGCGGCCAGG - Intronic
1181571046 22:23767962-23767984 GCGCAAAAAAGGCGGGGCCCCGG + Exonic
1183524838 22:38316995-38317017 GGGCCGAGCGGGCGGCGCCCGGG + Intronic
1183692682 22:39399795-39399817 CCTCCAAGATGGCGGCGCAGAGG + Exonic
1183713647 22:39521038-39521060 GAACCAAGATGGCGGCGGCAGGG + Exonic
1184131598 22:42519772-42519794 GTGGCAAGATGGTGGCGCGCAGG - Exonic
1184141817 22:42581987-42582009 GTGGCAAGATGGTGGCGCGCAGG - Intergenic
1184152624 22:42647556-42647578 TGGCCAAGATGGCGAAGCCCAGG + Intronic
1184620365 22:45672056-45672078 GCGGCAAGATGGCGGCGCCCAGG + Exonic
953024785 3:39138517-39138539 GAGCAAAGATGGTGGCACCCTGG - Intronic
954160362 3:48717206-48717228 GCACCAAAATGGCTGCGGCCAGG + Exonic
954540647 3:51391299-51391321 TGTCCAAGATGGCGGCGCCGGGG + Exonic
960684765 3:120285289-120285311 GCGCCACGCGGGCGGCGCCAGGG - Intergenic
962847145 3:139282692-139282714 GAGCCAAGCTGGGGGCACCCTGG + Intronic
970967885 4:21948880-21948902 GCGCGAAGCTGCCGGCGCCTCGG - Intergenic
971288476 4:25312802-25312824 GCGGGAAGATGGCGGCCTCCAGG + Exonic
985523416 5:389716-389738 GCGCAGATATGGCGGCCCCCAGG + Intronic
987088072 5:14487793-14487815 GCGCCCAGCAGGCGGCCCCCCGG + Exonic
989744232 5:44808955-44808977 GGGCAAAGATGGCGGCGGCCAGG + Exonic
999322652 5:150624856-150624878 GTGCCGAGGCGGCGGCGCCCGGG + Intronic
1002561162 5:180083223-180083245 GCGCCAGGCTGGCTGAGCCCTGG - Intergenic
1003433050 6:6058111-6058133 GCACCCAGCTGGCGTCGCCCAGG + Intergenic
1007699866 6:43760115-43760137 GAGCCAAGATGTCAGCTCCCAGG - Intergenic
1019453652 7:1113368-1113390 GCTCCCAGAAGGCGCCGCCCGGG + Intronic
1023522058 7:41058925-41058947 GCACCAATATGGCAGGGCCCTGG + Intergenic
1024537548 7:50450463-50450485 GGGCCTAGGTGGCGGTGCCCGGG - Intronic
1037273864 8:17156954-17156976 GCGGCAGGTTGGCAGCGCCCGGG - Intronic
1037626445 8:20611417-20611439 GTGCCAGGATGGCTGAGCCCTGG - Intergenic
1037840963 8:22245099-22245121 GCGCCAAGATGGCGGCGCCCAGG + Intronic
1040080346 8:43277285-43277307 GCTCCCAGGTGGCGGCGCCGAGG - Intergenic
1049264688 8:141661125-141661147 GCTCCAAGAAGGCAGCCCCCAGG - Intergenic
1049655261 8:143794387-143794409 GCGCCAAGAGGGAGGCTTCCGGG - Intronic
1053206572 9:36191146-36191168 GCGCCAAGAAGGCCGCAGCCGGG - Exonic
1056747735 9:89318746-89318768 GCGCGAAGATCGCGGCCACCCGG - Intronic
1061559662 9:131394306-131394328 GCGCTAAGATGGAGGCGGCGCGG + Intronic
1187915678 X:24150199-24150221 GGGACAAGATGGCGGCGGCTCGG + Intronic
1189974373 X:46447140-46447162 TGGCCAAGATGGCGGCTTCCAGG - Exonic
1190105934 X:47561328-47561350 GCTCCAGGATGGCTGCGCCTGGG + Intronic
1190225010 X:48538756-48538778 GCGGCAGGATGGCTGAGCCCAGG - Intergenic
1190702728 X:53000220-53000242 GCGCCAAGAAGGCAGATCCCTGG - Intergenic
1199248017 X:145630122-145630144 GTACCAACATGGTGGCGCCCAGG + Intergenic
1200155132 X:153971158-153971180 GGCTCAAGATGGCGGCTCCCAGG - Exonic
1200155358 X:153972091-153972113 GTGGCAAGATGGCGGCTCCCAGG - Intergenic
1201365789 Y:13204922-13204944 GCACAAAGATGGCGCTGCCCAGG + Intergenic