ID: 1037846046

View in Genome Browser
Species Human (GRCh38)
Location 8:22283150-22283172
Sequence TGGTGGTGATGACAGCTGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037846046_1037846057 20 Left 1037846046 8:22283150-22283172 CCCCGCAGCTGTCATCACCACCA 0: 1
1: 0
2: 1
3: 31
4: 228
Right 1037846057 8:22283193-22283215 GCACTCTCCAGATCGCCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037846046 Original CRISPR TGGTGGTGATGACAGCTGCG GGG (reversed) Exonic
900374593 1:2347635-2347657 CGGTGGGGAGGACACCTGCGTGG - Intronic
901275805 1:7990145-7990167 TGGTGGTGGTGACAACAGTGGGG - Intergenic
901662609 1:10808011-10808033 TGTGGGTTATCACAGCTGCGGGG - Intergenic
901703603 1:11058609-11058631 AGGTGGTGAGGGCACCTGCGTGG - Intronic
903042205 1:20539707-20539729 TGGAGGTGATGACAACAGAGGGG + Intergenic
903359297 1:22766826-22766848 TGGTGGTGATAGCAGCAGCCTGG - Intronic
903538939 1:24085983-24086005 TGATTGTGATGGCAGCTACGGGG + Intronic
904495062 1:30881913-30881935 AGGGGGTGAGGGCAGCTGCGGGG - Intronic
905022442 1:34827116-34827138 TGGTGGTGTTCAGAGCTGTGAGG - Intronic
905033845 1:34904707-34904729 TGGTGGTGATGGGAGGTGTGGGG + Exonic
905039769 1:34946379-34946401 TGGTGGTGATAACATCAGCAGGG - Intergenic
905180762 1:36164859-36164881 TGGTGATGATGATATCTGCCTGG + Intronic
905326310 1:37154543-37154565 TGGTGGTGGTCTCAGCTGCAGGG - Intergenic
905910219 1:41648351-41648373 TGGTGGTGATGATGGTTGAGTGG - Intronic
907456948 1:54582045-54582067 TGGTGGGGATAGCAACTGCGAGG + Intronic
907484350 1:54766783-54766805 GGGTGCTGAGGACAGCTGCCTGG - Intergenic
907642541 1:56205935-56205957 TGATGGTGATGGCAGGTGCTGGG - Intergenic
910009025 1:82437599-82437621 TAGTGCTAATGACAGCTGGGAGG - Intergenic
911721887 1:101200118-101200140 TGGTGGAGAAGACAGATGCGAGG - Intergenic
915509553 1:156378960-156378982 AGGTGGTGATGACAGATGACAGG - Intronic
918139047 1:181704740-181704762 TGGTTGTCATGACAGCAGCGAGG + Intronic
918178982 1:182069898-182069920 TGGAGGTGGTGACAGGTGGGTGG - Intergenic
920251208 1:204623583-204623605 AGGTGGTGATGGCAGGTGAGAGG - Intronic
921613706 1:217242321-217242343 TCATGGTGATGGCAGCTGTGGGG + Intergenic
921756814 1:218866853-218866875 CAGTGGTGATGACAGCTGAGTGG + Intergenic
922024698 1:221739600-221739622 TGGTGGCGATGACAGGAGGGTGG + Exonic
922176990 1:223204640-223204662 TGGTCGTGATGACCTCTGAGTGG + Intergenic
922780124 1:228245627-228245649 TGCTGGGGAGTACAGCTGCGAGG + Exonic
1065589562 10:27251497-27251519 GGGTGGGGCTGACATCTGCGAGG + Intergenic
1065717936 10:28591714-28591736 TGGCTGGGATTACAGCTGCGTGG - Intronic
1069039948 10:63685035-63685057 TGGTGGTGAAGAGAGTTGCTAGG + Intergenic
1070701524 10:78604900-78604922 TGGTGGTGGTGGCAGCTCCAGGG + Intergenic
1072865964 10:99061965-99061987 TGGTGGTGAGGAGAGCAGAGAGG + Intronic
1073202783 10:101749763-101749785 TGGCCGTGATAACAGCTGTGGGG - Intergenic
1074772694 10:116743580-116743602 TGCTGGTGGTTACAGCTGGGTGG - Intergenic
1076052603 10:127347455-127347477 GGGTGGTGAAGGCAGCTGAGAGG + Intronic
1077076211 11:703343-703365 TGGTGTTGGGAACAGCTGCGGGG + Exonic
1080532206 11:33188096-33188118 AGCTGGTGGTGACAGCTGCGAGG - Intergenic
1080737379 11:35030030-35030052 TGGTGATAATGACAGCTTCTTGG + Intergenic
1081879376 11:46434939-46434961 TGCTGGGGATGAAAGCTGCCAGG + Exonic
1083094110 11:60232541-60232563 TGGTGGTGATGGGAGCTGCTGGG - Intronic
1083099652 11:60289328-60289350 TGGTGGTGATGGGAGCTGCTGGG + Intronic
1083261655 11:61526353-61526375 TGGTGTTGATGAGAGCTGACTGG - Intronic
1083855705 11:65392100-65392122 TGGAGGTGGTGACAGATGGGTGG + Intronic
1083857662 11:65401079-65401101 CGGTGGTGGTGGCAGCTGTGGGG + Intronic
1084191781 11:67502676-67502698 TAGTGGTGAGGGCAGCGGCGTGG - Exonic
1084412485 11:69012777-69012799 TGGGGGTGAGGCCAGCTGAGAGG + Intronic
1084446257 11:69205277-69205299 TGGTGGTCATGACAGTAGCAGGG + Intergenic
1085531231 11:77193293-77193315 TGGTGGTGATGACAGTGTTGTGG + Intronic
1087548769 11:99619477-99619499 AGATGGTGATGACAGCTCCATGG - Intronic
1088601241 11:111478100-111478122 TGGTGGTGATGGCAGCTGCAGGG - Intronic
1088904113 11:114141073-114141095 AGGTGGTGAAGACAGCGGCGAGG - Intronic
1089339036 11:117745161-117745183 TGGGGGGGATGACAGCTGGGAGG + Intronic
1089365071 11:117916423-117916445 AGGAGGGGATGACAGCTGTGTGG - Intronic
1089883601 11:121798021-121798043 AGGTGGTGAAGTCAGCTGCTTGG + Intergenic
1091227461 11:133966186-133966208 TGGTGGTGGGCACAGCTGCCAGG + Intergenic
1092236967 12:6816389-6816411 TGGTGGTGATGAGAGGTGAGGGG + Exonic
1092466238 12:8735160-8735182 TGGTAATGATGTCAGCTGTGGGG + Intronic
1094512933 12:31106946-31106968 TTGGGGTCATGACAGATGCGAGG - Intergenic
1094658216 12:32441353-32441375 TGCTGGTGATGAATGCTGCCAGG + Intronic
1097106601 12:56629813-56629835 TGGTGGAGATGACTCCTGTGGGG - Intronic
1101611956 12:106301064-106301086 GGGTGGTGATGGCAGTTGTGTGG + Intronic
1102651215 12:114443914-114443936 TGGCGCTGATGAGCGCTGCGCGG + Intergenic
1103446836 12:121000267-121000289 TGGCTGTCATGACAGCTGCCAGG - Intronic
1104396745 12:128440499-128440521 TGTTGGTAGTGACAGCTGCAAGG - Intronic
1104404563 12:128506721-128506743 TGGTGGTGAGGACAGGAGCATGG - Intronic
1110131735 13:72019431-72019453 TGGTTGTGAGGACAGCAGCTAGG - Intergenic
1112399635 13:99064742-99064764 TGGTGGAGAAGACAGCTGGTCGG + Intronic
1114261685 14:21041570-21041592 TTGTGGTGGTTACAGCTGTGTGG - Intronic
1115576656 14:34717888-34717910 TGGTGGTAATAACAGCTCCAGGG - Intergenic
1115887748 14:37992791-37992813 TGATGGTGATGACAGTTGGCTGG - Intronic
1117584581 14:57187305-57187327 TAGAGGTGATGAGAGCTGCGTGG + Intergenic
1118908660 14:70043123-70043145 TTGTGGTGATCAAAGCTGTGAGG + Intergenic
1119434579 14:74589667-74589689 TGGTGGTGGTGACAGGGGCCTGG - Intronic
1122400670 14:101465509-101465531 TGGTGGTGGTCACAGATGCTGGG - Intergenic
1123500403 15:20877112-20877134 TGGCGTTAATGACAGCTGGGTGG - Intergenic
1123557646 15:21450805-21450827 TGGCGTTAATGACAGCTGGGTGG - Intergenic
1123593875 15:21888086-21888108 TGGCGTTAATGACAGCTGGGTGG - Intergenic
1123741703 15:23286534-23286556 TGGTGGTAGTGCCAGCTGCTCGG + Intergenic
1123745294 15:23316024-23316046 TGGTGGTAGTGCCAGCTGCTCGG - Intergenic
1125291461 15:38152668-38152690 TGGTGATCATGACAGCTTTGAGG - Intergenic
1125349383 15:38751833-38751855 GGGTGGTTTTGACAGCTGCAGGG + Intergenic
1125930864 15:43599243-43599265 TGGTGTGGATGACAGGTGTGGGG - Exonic
1125944031 15:43699059-43699081 TGGTGTGGATGACAGGTGTGGGG - Exonic
1127293572 15:57591470-57591492 TGGTGGGGATGACAGGTGCCGGG - Intergenic
1127304490 15:57691350-57691372 TGGTGGTGATAACATCTTCCAGG - Intronic
1128215366 15:65930749-65930771 AGGTGGTGCTGCCAGCTGAGGGG - Intronic
1128698990 15:69790171-69790193 TGGTGGTGGTGAGAGCTCTGAGG - Intergenic
1128717575 15:69919904-69919926 TGGCTGGGAGGACAGCTGCGAGG - Intergenic
1129385435 15:75193592-75193614 TGTTGGTTATGAAAGCTGGGAGG + Intergenic
1129923361 15:79339650-79339672 GGGTGGTGATGACAGAGGAGTGG + Intronic
1131408350 15:92184976-92184998 TGGTGGTGGTGAGAGCAGTGTGG + Intergenic
1131758636 15:95594676-95594698 CGTTGCTGATGACAGCTGCCAGG + Intergenic
1202966001 15_KI270727v1_random:177977-177999 TGGCGTTAATGACAGCTGGGTGG - Intergenic
1132792418 16:1699134-1699156 TGGCCGTCATGACAGCTGCTTGG + Exonic
1133996847 16:10754693-10754715 GGGGGGTGGTGACAGCTGAGGGG + Intronic
1136999478 16:35216589-35216611 TGGTGATGAAGACAGCTCAGCGG - Intergenic
1137003473 16:35251418-35251440 TGGTGATGAAGACAGCTCAGCGG + Intergenic
1137902931 16:52288849-52288871 TGGTGGTGAGGACACATGAGTGG - Intergenic
1137922199 16:52501532-52501554 TGGTGGTGATCCCAGCTACTAGG + Intronic
1138500099 16:57436114-57436136 TAGTGGTGGTGACAGCTGAGGGG - Intronic
1138703699 16:58892612-58892634 TGGTGGTGGTGGTAGCTGTGTGG - Intergenic
1138703718 16:58892707-58892729 TGGTGGTGGTGGTAGCTGTGTGG - Intergenic
1138703734 16:58892802-58892824 TGGTGGTGGTGGCAGCTGTGTGG - Intergenic
1138703751 16:58892888-58892910 TGGTGGTCATGATAGCTGTGTGG - Intergenic
1139371735 16:66473324-66473346 TGGTGGTGGTGACCCCTGTGGGG + Intronic
1142663231 17:1445802-1445824 TGGTTCTGATCACAGCTGGGTGG + Intronic
1143663022 17:8338947-8338969 TGGTGGTGATGGGAGGTGAGAGG - Intergenic
1145794972 17:27650156-27650178 TGCTGGTGCTGCCAGCTCCGAGG - Intergenic
1146540286 17:33687599-33687621 TGAAGGGGATGAGAGCTGCGTGG - Intronic
1146644234 17:34566418-34566440 TGTTGGTGATGACAGTAACGAGG + Intergenic
1148049333 17:44761416-44761438 TGGTGGTGTCTGCAGCTGCGTGG + Intronic
1150249259 17:63697259-63697281 AGGGGATGATGACAGCAGCGAGG + Exonic
1151935491 17:77258400-77258422 CGGTGGTGGTGACAGCTGTTGGG - Intergenic
1152069252 17:78126948-78126970 GGGTGGTGTGGACAGCTGCCAGG - Intronic
1152175581 17:78784981-78785003 TGGTGGTAATCCCAGCTACGTGG - Intergenic
1152318485 17:79594769-79594791 TGGGGGTGTAGGCAGCTGCGAGG + Intergenic
1154201329 18:12302567-12302589 TGGTGGTGAGGCCTGCTGCAGGG - Intergenic
1154291004 18:13106576-13106598 TGGTGGTGGTGGTAGCTGTGTGG - Intronic
1154291033 18:13106739-13106761 TGGTGGTGGTGGTAGCTGTGTGG - Intronic
1155188457 18:23408544-23408566 TGCTGGTGTTGACAGCTACTCGG + Intronic
1155517414 18:26637415-26637437 TGGTGCTGATGTGAGCTGCGAGG + Intronic
1157537224 18:48468706-48468728 CGGTGGAGATGGCAGCTGCCTGG - Intergenic
1157741497 18:50097194-50097216 TGGGAGTGATGACATCTGTGGGG - Intronic
1161440993 19:4291546-4291568 TGGGAGTGATGCCAGCTGCGGGG + Intergenic
1163278905 19:16303112-16303134 TGGCTGGGATGACAGGTGCGCGG - Intergenic
1163427409 19:17246820-17246842 TGGAGGTGGCGGCAGCTGCGAGG - Intronic
1166852062 19:45765830-45765852 TGGAGGTGGTGGCAGCGGCGGGG + Exonic
1167422802 19:49413961-49413983 TGGTGGTGGTGGCAACTGCAGGG + Intronic
1167576706 19:50321112-50321134 TGGTGGTGGTGCCAGGTGTGGGG + Intronic
1168116151 19:54222270-54222292 AGCTGGTGATGACAGGTGAGAGG - Exonic
1168119134 19:54242018-54242040 AGCTGGTGATGACAGGTGAGAGG - Exonic
1168125382 19:54279783-54279805 TGCTGGTGATGACAGGTGAGAGG - Exonic
1168128042 19:54298097-54298119 TGCTGGTGGTGACAGGTGAGAGG - Intergenic
1168181203 19:54664024-54664046 AGCTGGTGATGACAGGTGAGAGG + Exonic
1168185412 19:54697050-54697072 AGCTGGTGATGACAGGTGAGAGG + Intronic
1168240459 19:55086524-55086546 TGGTGGGGACGCCGGCTGCGGGG + Intronic
1168664354 19:58192114-58192136 TGGTGGTGAAGACAGCTTCTAGG + Intronic
926105875 2:10150604-10150626 TGATGGTTGTGACAGCTGCATGG - Intronic
926332664 2:11838138-11838160 TGGTGGTGGTGACAGATGGGAGG + Intergenic
927746650 2:25628271-25628293 TGGAGGAGATGACAGTTTCGAGG + Exonic
929846285 2:45532145-45532167 TGGTGGTGATGGCAGCGGCATGG - Intronic
933847302 2:86336751-86336773 TGGTGGCGATGACACCTCCCAGG - Intronic
935353712 2:102178255-102178277 TGGTGGTGAGCACATCTGGGAGG + Exonic
938203478 2:129397292-129397314 TGGCTGTGATGAAAGCTGCAGGG - Intergenic
942066748 2:172278881-172278903 TGTCGGTGATGACATCTGCAAGG + Intergenic
943520330 2:188941706-188941728 TGGTAGTGATGACGGGTGGGTGG + Intergenic
947793513 2:232880665-232880687 TGGTACTGATGACAGCAGCAGGG + Intronic
1169406227 20:5323629-5323651 TGGTAGGGATGAGAGCTGGGAGG + Intergenic
1174252333 20:49228965-49228987 TGGTGTTGGTGACAGGTGCCAGG + Intronic
1174404154 20:50292869-50292891 GGGTGGGGAGGACAGCTGAGTGG - Intergenic
1174576544 20:51541848-51541870 AGGAGGTGATGGGAGCTGCGTGG + Intronic
1175593704 20:60213637-60213659 TGGTCCTGATGACAGCTGGAAGG - Intergenic
1179157690 21:38864168-38864190 TGGTGGTGATTGCAGCTCCTTGG + Intergenic
1180847812 22:18993977-18993999 TGGTGGTGGTTCCAGCAGCGGGG + Intergenic
1183176152 22:36226093-36226115 TGGTTGTGATGGCAGCAGAGTGG - Intergenic
1183182174 22:36267619-36267641 TGGTTGTGATGGCAGCAGAGTGG + Intergenic
1183674984 22:39294176-39294198 TGGGGCTGGTGACAGCTGCGGGG + Intergenic
1183749520 22:39711950-39711972 AGGTGGAGATGACAGCAGTGGGG + Intergenic
1184777506 22:46630828-46630850 TGGTGGTCCTGGCAGCTGTGCGG + Intronic
1185398000 22:50602207-50602229 AGGTTGTGATGGCAGCTGCCAGG - Intronic
1203215329 22_KI270731v1_random:2919-2941 GGGTGCTGCTGACACCTGCGAGG + Intergenic
950118803 3:10468248-10468270 TGGTGGGGCTGACAGGTGCGAGG + Intronic
950882578 3:16335220-16335242 TGGAGGTGCTGACAGATGCAGGG + Intronic
951508447 3:23475428-23475450 TGGTGGTAATGACAGGAGCATGG - Intronic
952885316 3:38008238-38008260 TGTTGGTGATGACAGCAGTCTGG + Exonic
954463196 3:50639296-50639318 TGAGGGAGATGACAGCTGAGTGG - Intronic
955309457 3:57870505-57870527 TGATGGTGATGATAGATGAGAGG + Intronic
957717107 3:83942417-83942439 TGGTCGTGTTGACAGCTCAGTGG + Intergenic
958787931 3:98618658-98618680 TGGTGGTGGTGGCAGCGGGGAGG + Intergenic
959847501 3:111051296-111051318 TTGTGGTGGTGACAGTTGCAGGG + Intergenic
960264527 3:115605274-115605296 TGGTGGTGGTGGAAGCTGTGGGG + Intergenic
961660397 3:128465683-128465705 TGCTGGTGGTGACAGCAGCAAGG + Exonic
962959204 3:140294418-140294440 TGGTGGAGGTGACATCTGCCTGG - Intronic
963248309 3:143082963-143082985 TGGTGGTTATGGCAGGTGTGAGG + Intergenic
964846591 3:161051090-161051112 TGGTGGAGAGGATAGCTGGGAGG - Intronic
967117497 3:186355168-186355190 TGGTGGTGGTGATAGTTGTGGGG - Intronic
967864128 3:194176240-194176262 TGGTTGGGATGACAGCTTCATGG + Intergenic
968809905 4:2795110-2795132 TGGTGGTGGTGACATGTGCTTGG + Intronic
968943492 4:3651735-3651757 TGGTGGTGAAGGCAGCGGTGAGG - Intergenic
969155905 4:5209667-5209689 TGGTGTAGATGGCAGCTGCTGGG - Intronic
969252041 4:5974321-5974343 TGATGGTGATGAGAGCGGTGGGG + Intronic
972405521 4:38742719-38742741 TGGTGGTGTTGAGAGCTGGAGGG - Intergenic
973759133 4:54100848-54100870 TGGCGGTGCAGACAGGTGCGTGG - Exonic
974118867 4:57613610-57613632 TGATGGTCAGGACAGCTGGGTGG - Intergenic
976871030 4:89793832-89793854 TGGTGGTGGTGCCAGCAGTGGGG + Intronic
983566981 4:169163727-169163749 TGGAGGTGATGACAGCAGACTGG - Intronic
983644551 4:169976701-169976723 TCATGGTGGTGACAGCAGCGGGG + Intergenic
986036450 5:3945002-3945024 TGGTGGAGATGTAAGGTGCGTGG + Intergenic
986690623 5:10310686-10310708 TGCTGGTGAAGACAGGTGAGAGG + Intergenic
986765687 5:10924040-10924062 AGCTGGTGATGACAGATGCTGGG - Intergenic
987795858 5:22626025-22626047 TGGTGGTGGTGACATCTGGATGG - Intronic
988381911 5:30508289-30508311 TGATGGAGATGACAGCTAGGAGG - Intergenic
993551992 5:89284631-89284653 TGGTGGTGATGACAGAGAGGAGG - Intergenic
995358267 5:111264325-111264347 CGATGGTGATGTCAGCTGCCTGG + Intronic
999283870 5:150382530-150382552 TGGTGGTGATGGCAGCTCAGTGG - Intronic
1001061441 5:168493132-168493154 TGGTGGTGATGAGTGCTGGGAGG + Intronic
1001098526 5:168795122-168795144 CAGTGGTGTAGACAGCTGCGGGG + Intronic
1001206194 5:169765444-169765466 TGGTGGTGATGACAGGAGAAAGG + Intronic
1002515963 5:179759068-179759090 TTCTGGTAATGACAGCTGCTGGG + Intronic
1003645931 6:7912745-7912767 TGCTGGTGATGACAAGTGCTAGG - Intronic
1004594038 6:17081883-17081905 TGGTGGTGGTGACAGGTGGGGGG - Intergenic
1004763187 6:18693934-18693956 TGGTGATGAGGGCAGCGGCGGGG + Intergenic
1006152400 6:31996494-31996516 AGGCCGTGATGGCAGCTGCGTGG - Exonic
1006158701 6:32029232-32029254 AGGCCGTGATGGCAGCTGCGTGG - Exonic
1007585168 6:42984843-42984865 TGGGGGTGCTGCCAGCCGCGGGG - Intronic
1008689708 6:53964340-53964362 TGGTGTTGATTCCAGCTGCCAGG - Intronic
1010487435 6:76432374-76432396 TGGGGGTGATGAAAGGTGTGTGG + Intergenic
1012366597 6:98448251-98448273 TGTTGGTAATGATAGCTGGGTGG + Intergenic
1015808108 6:137132921-137132943 AGGTGGTGATGAGGGCTGCTGGG - Intergenic
1017401874 6:154073864-154073886 TGGTGGTGATCCCAGCTACTCGG + Intronic
1017630597 6:156392861-156392883 TGGTGGTGAGCACAGCTGTCTGG - Intergenic
1018592959 6:165447444-165447466 TGGAGGTGAGCACAGCTGCGTGG + Intronic
1019129019 6:169860039-169860061 TGGTGGGGCTGACAGGTGCTGGG + Intergenic
1019164959 6:170091926-170091948 TGGTGCTGTTGTGAGCTGCGTGG - Intergenic
1019165021 6:170093026-170093048 TGGTGCTGTTGGGAGCTGCGTGG - Intergenic
1019205326 6:170356968-170356990 TGGGGGTGCTGACTGCTGCTTGG - Intronic
1019632446 7:2056924-2056946 TTGTGGTAATGATAGCTGCACGG - Intronic
1020743833 7:12055761-12055783 TGGTGGTGGTGAGAGCTCCTGGG - Intergenic
1023682323 7:42700010-42700032 TGGTGGTGGTGAAGGCAGCGAGG + Intergenic
1029456674 7:100675373-100675395 GGGTGGGGGTGACAGCGGCGGGG - Intronic
1030775471 7:113529736-113529758 TGGTGTTGATGATAGTTGCTGGG - Intergenic
1033862374 7:145644104-145644126 TTGTGGTGGTGTCAGCTGCTTGG + Intergenic
1034412415 7:150948252-150948274 TGGAGGAGGTGACAGCTGCAGGG + Intronic
1034422608 7:150997295-150997317 CGGGGGTGAGGACAGCTGAGCGG + Intronic
1035380980 7:158440828-158440850 TGGTGGTGATGGCAGTGACGGGG + Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1035565792 8:640059-640081 AAGTGGGGATGACAGCTGTGTGG - Intronic
1035739516 8:1915585-1915607 TGGTGGCGATGCCACATGCGTGG + Intronic
1037004393 8:13759434-13759456 TGGTGGTGATCAGGGCTGCTGGG - Intergenic
1037368699 8:18149906-18149928 TGGTGCTGACCACAGCTGCCAGG + Intergenic
1037801950 8:22040738-22040760 TGGTGGAGGTGTCAGCTGGGGGG - Intergenic
1037846046 8:22283150-22283172 TGGTGGTGATGACAGCTGCGGGG - Exonic
1038715649 8:29988301-29988323 CCGTGGTGAAGGCAGCTGCGGGG - Intergenic
1041146723 8:54883822-54883844 TGGTGCTGATGGGAGCTGCAAGG + Intergenic
1041942884 8:63408309-63408331 TGTTGGTTATGACAGCTGGCTGG + Intergenic
1042348223 8:67749565-67749587 TGGTGCTGAAGACAGCTGGGAGG - Intergenic
1046630736 8:116620583-116620605 TCGTGGTGATAACATCTTCGAGG + Intergenic
1046632661 8:116636760-116636782 TGCTGGTGAAGACAGGTGCTTGG + Intergenic
1049428392 8:142547911-142547933 AGGTGGTGGTGACAGTTTCGTGG + Intergenic
1049541361 8:143210636-143210658 TGGTCCTGATGGCAGCTGCATGG - Intergenic
1049826572 8:144672586-144672608 TGGTGGTGTAGACAGATGTGAGG - Intergenic
1051255188 9:15205807-15205829 TGGTGGTGATGGCAGCGGTGGGG + Intronic
1051719522 9:20021821-20021843 AGGAGGTGATGACGGCTGCTTGG - Intergenic
1056267865 9:84917428-84917450 TGGTTGCAATGACAGCTGCATGG + Intronic
1056588493 9:87944822-87944844 TGGTGGTGGTGGCGGCGGCGGGG + Intergenic
1056891045 9:90492983-90493005 TGGTTGTGAGGACAGCTGTTAGG - Intergenic
1057249894 9:93492685-93492707 TGGTGGGGAGGGCAGCTGCATGG + Intronic
1057979974 9:99650647-99650669 TGGTGGTGGTGATAGCTCCGGGG - Intergenic
1062193323 9:135258822-135258844 TGGCAGTGATGCCAACTGCGTGG + Intergenic
1062235375 9:135505447-135505469 TGCTGGGGAGGCCAGCTGCGGGG + Intergenic
1062256349 9:135624082-135624104 TGCTGGTGATAACAGCTAGGTGG + Exonic
1062495648 9:136830384-136830406 TGGTGGTGCTGAAGGCTGGGAGG - Intronic
1188139705 X:26534703-26534725 TGGTGCTGAAGACAGCTTCCAGG + Intergenic
1190775888 X:53552014-53552036 AGGGGGTGATGATATCTGCGTGG - Intronic
1192182055 X:68922279-68922301 TGGGGCTAATGACAGCTGAGTGG - Intergenic
1192849232 X:74936510-74936532 TGGTGGTGGTGACAGTGGCTAGG + Intergenic
1199812122 X:151360291-151360313 TGGTGGTGAGGACACCAGCTTGG - Intergenic
1200089421 X:153627345-153627367 TGGTGGTGGAGGCAGCAGCGCGG + Intergenic
1201766472 Y:17577539-17577561 GGGTGGTGATGACAGATGGGTGG - Intergenic
1201835080 Y:18328450-18328472 GGGTGGTGATGACAGATGGGTGG + Intergenic