ID: 1037848108

View in Genome Browser
Species Human (GRCh38)
Location 8:22302599-22302621
Sequence GGGGTGATCACTAGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037848108_1037848115 15 Left 1037848108 8:22302599-22302621 CCTGGCTTCCTAGTGATCACCCC 0: 1
1: 0
2: 4
3: 12
4: 137
Right 1037848115 8:22302637-22302659 TAGTCATTCGGATAATGATTTGG No data
1037848108_1037848114 3 Left 1037848108 8:22302599-22302621 CCTGGCTTCCTAGTGATCACCCC 0: 1
1: 0
2: 4
3: 12
4: 137
Right 1037848114 8:22302625-22302647 GTCTGTAGAGCTTAGTCATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037848108 Original CRISPR GGGGTGATCACTAGGAAGCC AGG (reversed) Intronic
900405007 1:2489081-2489103 GGGGTCTTCACCAGGAACCCAGG - Intronic
900769325 1:4528319-4528341 GGGGTGAACAGTGGGAAGCGGGG + Intergenic
902685388 1:18073392-18073414 GGGGTCTTCACCAGGAAGGCTGG - Intergenic
903378314 1:22880132-22880154 GGGGTGCCCAGGAGGAAGCCAGG + Intronic
910969967 1:92846056-92846078 GGGGTAAGCACCAGGAGGCCTGG - Intronic
913313762 1:117532593-117532615 GGGCTGACTCCTAGGAAGCCAGG - Intergenic
915291002 1:154883358-154883380 AGGTTGATCACAAGGTAGCCAGG + Intergenic
918068093 1:181115191-181115213 AGGGTGTTCACCAGGAAGTCTGG - Intergenic
919074663 1:192798606-192798628 GGGCTGATCCCTAGGAAGTGGGG - Intergenic
920446480 1:206022318-206022340 AGGGTGCTCACCAGGAAGCCAGG + Intronic
922787254 1:228289171-228289193 AGGGTAAACACTAGGAAGGCAGG + Intronic
924066275 1:240225412-240225434 GGGGTGACCCATAGGTAGCCAGG + Intronic
1062864246 10:836841-836863 GGGATGATCATCAGGGAGCCAGG - Intronic
1063112975 10:3052858-3052880 GCGGTGATCACCAGGAAGTAAGG + Intergenic
1064043441 10:11988958-11988980 GGCTTGATCCCTAGGGAGCCTGG - Intronic
1064103833 10:12484871-12484893 GGTGTGATGACCAGGAAGCAGGG + Intronic
1064856586 10:19775263-19775285 GGGGTGAAGACTTGGAAGCAGGG - Intronic
1065135986 10:22670465-22670487 GGGGTGTTCACTACAAAGACAGG + Intronic
1065269769 10:24016330-24016352 GGGATGACCCCTAGGAAGCCAGG - Intronic
1065270091 10:24020714-24020736 GGGATGATCCCTAGGAAGCCAGG + Intronic
1065421245 10:25546827-25546849 GGGGTGAACAGGAGAAAGCCAGG + Intronic
1066260319 10:33723574-33723596 AGGTTTATCACTAGGCAGCCAGG - Intergenic
1067264776 10:44731292-44731314 GGTGTGAGTTCTAGGAAGCCAGG - Intergenic
1070345695 10:75539652-75539674 GTGGTGATTTGTAGGAAGCCTGG + Intronic
1071101199 10:82039738-82039760 GGAGTGATCTTTAGGAAGACTGG + Intronic
1072429763 10:95360510-95360532 GGGCTGATCAGTTGGCAGCCTGG - Intronic
1072791343 10:98320538-98320560 AGGGTTATCACTAGGAACCCAGG + Intergenic
1073329398 10:102660881-102660903 GGGGGGTTCCCTAGGCAGCCAGG + Intergenic
1074309365 10:112308886-112308908 GGGGTGTTCAAGAGGAAGCTAGG + Intergenic
1076333794 10:129691604-129691626 GGGGGGAGCACAAAGAAGCCAGG + Intronic
1076731557 10:132441483-132441505 GGGGAGCTCATTAGGTAGCCAGG - Intergenic
1077742809 11:4866121-4866143 TGGGCGATTCCTAGGAAGCCAGG + Intronic
1078516444 11:12026727-12026749 GAGTTGATCAATAGGAAGCAAGG + Intergenic
1083123646 11:60540860-60540882 GGGAGGATCACTTGGAACCCAGG + Intronic
1086280996 11:85188269-85188291 GGGGTGACCCATAGAAAGCCAGG + Intronic
1090524782 11:127521649-127521671 GAGGAGATTCCTAGGAAGCCAGG - Intergenic
1091865787 12:3834987-3835009 GGGGTAATTCCTATGAAGCCAGG + Intronic
1093640387 12:21520816-21520838 GGTGTGATCAATAGGAAGATGGG - Intergenic
1096850257 12:54430919-54430941 GGGGTGATGGGAAGGAAGCCAGG + Intergenic
1098530572 12:71537225-71537247 GGGAGGATCACTTGGAGGCCAGG + Intronic
1099206225 12:79730397-79730419 GGGCAGATCACTGGGAGGCCAGG - Intergenic
1101542612 12:105678541-105678563 GAGGTGACCACTAGGAAGGAGGG + Intergenic
1102359526 12:112272387-112272409 GGGGTGAACCCTAGGAAGCCAGG - Intronic
1102392506 12:112560628-112560650 GGGGGGATCACTAGAAACCCAGG - Intergenic
1107316851 13:39141597-39141619 GTGGTGATCATTAGAAAGTCAGG - Intergenic
1109828726 13:67757426-67757448 GGGGTGAGCAGGATGAAGCCTGG - Intergenic
1113744583 13:112734781-112734803 GGGGGGATCACTATGGTGCCTGG + Intronic
1114743860 14:25125455-25125477 GGAGTGATCACTGGGCAGACAGG + Intergenic
1115060234 14:29179006-29179028 GGGGTGTTCACTGAGAAACCTGG - Intergenic
1117024929 14:51609456-51609478 GGGGAGAACACTAGGAAGGAGGG + Intronic
1120751410 14:88202123-88202145 GGGGTGAACATCAGGAGGCCTGG - Intronic
1121442235 14:93956524-93956546 GGGGGGATCACCAGCATGCCTGG + Intronic
1125546196 15:40507355-40507377 TGGGTGAGCAATGGGAAGCCAGG + Intergenic
1129049976 15:72772973-72772995 GGGCTGAGGACTAGGAAGCTGGG - Intronic
1129740975 15:77989540-77989562 GGGCTGATAACAACGAAGCCTGG + Intronic
1129844744 15:78763012-78763034 GGGCTGATAACAACGAAGCCTGG - Intronic
1131103288 15:89711432-89711454 GGGAAGATCACTTGCAAGCCAGG + Intronic
1132324802 15:100959632-100959654 GGGGTGATTTCCAGGAGGCCTGG - Intronic
1132715120 16:1286284-1286306 GGGGTGTCCACAAGGAAGACGGG + Intergenic
1133201472 16:4206930-4206952 GTGGGGATCCCCAGGAAGCCAGG - Intronic
1133361082 16:5174284-5174306 GGGATGATCCACAGGAAGCCTGG + Intergenic
1136428149 16:30183054-30183076 GGGGTGTTCCCGATGAAGCCAGG + Intronic
1137572502 16:49575981-49576003 GGGGTGATCAGGAGAGAGCCAGG - Intronic
1138457202 16:57128007-57128029 GGGGTGAACACAGGGAAGGCAGG - Intronic
1139546807 16:67653393-67653415 GGGGTGGTCAGGAAGAAGCCAGG - Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1145073616 17:19832689-19832711 GGGGTGACCCCTAGGAAACTGGG + Intronic
1147832918 17:43309763-43309785 AGTGTGGTCACTTGGAAGCCTGG + Intergenic
1150245700 17:63673460-63673482 GGGGAGATCACTAGGCAGATAGG + Intronic
1151953267 17:77366999-77367021 GGGGGGATCACTGGGAAGTCTGG + Intronic
1153739278 18:8106076-8106098 GGAGTCAAGACTAGGAAGCCTGG + Intronic
1156627608 18:38927989-38928011 GGGATTATCAGCAGGAAGCCAGG + Intergenic
1156894066 18:42224474-42224496 GGGATGACCCCTAGGAAGCCAGG - Intergenic
1157956054 18:52098945-52098967 GGGGTGACCAGTAGGGAGCTAGG + Intergenic
1158148074 18:54338412-54338434 GGAGTGATCCATAGGAGGCCAGG + Intronic
1158624764 18:59061551-59061573 AGGGTCAGCACCAGGAAGCCCGG + Intergenic
1160009712 18:75097320-75097342 GGGATGATTCCTAGGAAGTCAGG - Intergenic
1160036383 18:75305250-75305272 GGAGTGATCACTCCAAAGCCTGG + Intergenic
1160519744 18:79497875-79497897 AGGGTGATCCCTAGGCAGCCTGG + Intronic
1161851571 19:6740305-6740327 GGGGTGAGCAGGGGGAAGCCAGG - Intronic
1163155485 19:15437948-15437970 GGGGTGACAACCAGGAAACCAGG - Intronic
1163273638 19:16268976-16268998 GGGCAGCTCACGAGGAAGCCAGG - Intergenic
1163312174 19:16521229-16521251 GGGGTGACCACTGGGAAGGGTGG + Exonic
1163371943 19:16906012-16906034 GGGATGATTTCCAGGAAGCCTGG + Intronic
1166365136 19:42274334-42274356 GGGGTGGCCAGTGGGAAGCCTGG + Intronic
925450033 2:3961321-3961343 GGGCGGATCACGAGGAAGTCAGG - Intergenic
928523446 2:32114460-32114482 GGGGTGGTCACTAGGTAGATAGG - Intronic
932301229 2:70668297-70668319 GGGGTGGTGCCTAGGAAGCTGGG - Intronic
936908754 2:117568456-117568478 ATGGTGATCACTAAGAAGTCAGG + Intergenic
939289343 2:140173282-140173304 GTGGTGATGAGTAGGAAGCAGGG + Intergenic
943011492 2:182455229-182455251 ATGGTGATCACTAAGAAGTCAGG + Intronic
947636879 2:231684734-231684756 GGGCTGGTCCCTAAGAAGCCAGG + Intergenic
948352081 2:237349111-237349133 GGGGTGATGACTTGGAAGGAAGG - Intronic
948862583 2:240760134-240760156 GGGGTGGTGAGGAGGAAGCCTGG - Intronic
1169139952 20:3222063-3222085 GGGGTGGACACTAGGAATCTGGG + Intronic
1174935619 20:54865008-54865030 TGGGTGATCTCTAGGAAGCCTGG + Intergenic
1174937121 20:54882836-54882858 GTGGTGATCATTAGAAAGTCAGG - Intergenic
1175047988 20:56125413-56125435 GGTGTGATCAGCAGGCAGCCAGG + Intergenic
1175916255 20:62427374-62427396 GGGGTGCTCACCAGGGAGGCTGG - Intronic
1182830698 22:33302432-33302454 GGGATTAACACTAGGAAACCCGG + Intronic
950404964 3:12798495-12798517 GGGGTGCACAGTAGGGAGCCTGG - Intronic
953899294 3:46830250-46830272 GGGGTGATCACTGGGCCACCAGG + Intronic
954081932 3:48217542-48217564 GGGGTGAACAGCAGGAGGCCTGG + Intergenic
955441654 3:58962547-58962569 GCAGTGACCCCTAGGAAGCCAGG - Intronic
958893842 3:99808690-99808712 GGGATGCTCACTTGGAACCCAGG - Intergenic
960564637 3:119120236-119120258 AGAGTGATCCCTAGAAAGCCAGG + Intronic
961213501 3:125142694-125142716 GGGGAGCTCATTAGGAAGGCTGG - Intronic
969526051 4:7704647-7704669 GGGCTGAGCAGAAGGAAGCCGGG - Intronic
973991477 4:56412809-56412831 AGGGTGAAAACTAGGGAGCCCGG - Intronic
974353824 4:60785825-60785847 TGGGTCATCACTAGGAAAACTGG - Intergenic
974851120 4:67405966-67405988 ATGGTGATCACTAAGAAGTCAGG - Intergenic
981018295 4:139998863-139998885 GGGGTAACAAATAGGAAGCCAGG - Intronic
982284509 4:153721126-153721148 GGGATGATCACAAAGAATCCTGG - Intronic
983922443 4:173360322-173360344 GAGGTGATCTCTAGGAAGAGTGG - Intergenic
995967778 5:117930320-117930342 TGAGTGATCATTTGGAAGCCTGG - Intergenic
996843531 5:127874669-127874691 GGGCTGGTAATTAGGAAGCCGGG - Intergenic
999096975 5:148988336-148988358 GGCATGAGCACTGGGAAGCCTGG - Intronic
1006239378 6:32664571-32664593 GGGGGGGACACTAGGCAGCCTGG + Intronic
1006970233 6:38036237-38036259 GGGGTGACCCCTAAGAAGCCAGG + Intronic
1007207025 6:40161058-40161080 GTGGTGATTAGTAGGAAGCTGGG - Intergenic
1007732511 6:43955788-43955810 GGGGCAATTCCTAGGAAGCCAGG + Intergenic
1009437247 6:63632917-63632939 GGGGTGGTGCCTAGGAAGGCTGG - Intergenic
1009897359 6:69769809-69769831 GGAGCAATCCCTAGGAAGCCAGG - Intronic
1018286438 6:162244255-162244277 GAGGTGATGAGTAAGAAGCCAGG + Intronic
1018881138 6:167882368-167882390 AGGGGGATCAAAAGGAAGCCAGG + Intronic
1019414720 7:922021-922043 GGAGTGAGCACCAGGAAGTCGGG + Intronic
1019660318 7:2220337-2220359 GGAGTGGTCAGGAGGAAGCCTGG - Intronic
1020064520 7:5177202-5177224 GCGGTGACTCCTAGGAAGCCAGG + Intergenic
1023100082 7:36708788-36708810 GGAGTGATCCTTAGAAAGCCAGG - Intronic
1023157530 7:37265860-37265882 GTGCTGTTAACTAGGAAGCCTGG - Intronic
1024412615 7:49063356-49063378 CAGGTGATCTGTAGGAAGCCAGG + Intergenic
1026420351 7:70230392-70230414 GGGGTGGTCCCTAGAAAGCTAGG - Intronic
1028472783 7:91223029-91223051 GGAGGGTTCACTGGGAAGCCTGG + Intergenic
1029697603 7:102224432-102224454 GGGCAGATCACTTGGAAGACAGG - Intronic
1036439839 8:8772465-8772487 GGGGTGAGGCCTAGGAAGCCAGG - Intergenic
1037848108 8:22302599-22302621 GGGGTGATCACTAGGAAGCCAGG - Intronic
1051220335 9:14842330-14842352 GGGGAGATCATGAAGAAGCCAGG - Exonic
1055330579 9:75178846-75178868 GGAGTGATCAGTTGGAAGGCAGG - Intergenic
1058105233 9:100962914-100962936 GTGGTGATCATTAAGAAGTCAGG - Intergenic
1060881320 9:127120236-127120258 GGGGAGATCAATAGGCAGACAGG + Intronic
1060892923 9:127199719-127199741 CCGGTGATCTCTAGGAAGGCAGG + Intronic
1061760148 9:132845561-132845583 GAGGGGATCACTTGGAAGTCAGG + Intronic
1062080221 9:134619835-134619857 TGGGTGATCAGATGGAAGCCAGG + Intergenic
1062113447 9:134795286-134795308 CGGGGCATCACTGGGAAGCCTGG + Exonic
1062119634 9:134827394-134827416 GGGTTTGTCACTAGGAAGGCAGG - Intronic
1186101989 X:6167170-6167192 GGAGAGATGACTAGGAAGACAGG - Intronic
1187652243 X:21421732-21421754 GGGATCATCACTAGGAGGGCAGG + Intronic
1189310791 X:40015876-40015898 GGGGAGATCACAAGCAAGCCTGG + Intergenic
1189531958 X:41893741-41893763 GGGGAAAACCCTAGGAAGCCAGG + Intronic
1190437741 X:50443180-50443202 GGGGTGAACACCAGGAGGCAGGG + Intronic
1190717507 X:53116150-53116172 GGTGTGACCCCTAGGAATCCAGG - Intergenic
1193789597 X:85801622-85801644 AGGGTGACCCCTAGGAAGCCAGG - Intergenic
1194414021 X:93588518-93588540 GGTGTGATCACTAGGAATCCAGG + Intergenic