ID: 1037849437

View in Genome Browser
Species Human (GRCh38)
Location 8:22314615-22314637
Sequence CTGTTCATTTGGAAGCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 180}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037849437_1037849441 7 Left 1037849437 8:22314615-22314637 CCCTCATGCTTCCAAATGAACAG 0: 1
1: 0
2: 2
3: 10
4: 180
Right 1037849441 8:22314645-22314667 TGTTCCGAGGTTGAGTCACCAGG No data
1037849437_1037849440 -6 Left 1037849437 8:22314615-22314637 CCCTCATGCTTCCAAATGAACAG 0: 1
1: 0
2: 2
3: 10
4: 180
Right 1037849440 8:22314632-22314654 GAACAGTTTCGCTTGTTCCGAGG No data
1037849437_1037849442 10 Left 1037849437 8:22314615-22314637 CCCTCATGCTTCCAAATGAACAG 0: 1
1: 0
2: 2
3: 10
4: 180
Right 1037849442 8:22314648-22314670 TCCGAGGTTGAGTCACCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037849437 Original CRISPR CTGTTCATTTGGAAGCATGA GGG (reversed) Intronic
900627383 1:3615099-3615121 AAATTCATTTGGAAGAATGACGG - Intergenic
904629097 1:31828207-31828229 CTGGTCATTAAGAAGCCTGATGG - Intergenic
905975119 1:42168771-42168793 CTGCCCATATGGAAGAATGAGGG - Intergenic
906100606 1:43257953-43257975 CTGTGCACCTGGAAGCAGGAGGG + Intronic
906554761 1:46700390-46700412 CTGTTCATTTAAAAACAAGATGG + Intronic
907375115 1:54030786-54030808 CTTTTCATTTGGACTCAGGAAGG + Intergenic
910097990 1:83546233-83546255 CTGTACACTTGGAATCATGGGGG + Intergenic
911453549 1:98095637-98095659 GTGTTTATTTGGAACCAGGAAGG + Intergenic
912524591 1:110271820-110271842 CTGTACAGTTGGCAGCAAGAGGG - Intronic
915287074 1:154859952-154859974 CTGTTCATTTAGTATCATCAAGG + Intronic
916833424 1:168516459-168516481 CTGTTCATTTGGAAGTCAGCTGG + Intergenic
917644721 1:177018695-177018717 CTGTCCATATGGCAGAATGAAGG + Intronic
918140476 1:181715530-181715552 CCCTTCATTTTAAAGCATGAGGG - Intronic
919166382 1:193899494-193899516 GTGACCTTTTGGAAGCATGATGG + Intergenic
919202805 1:194379385-194379407 CGGTTCAATTTGAAGCCTGAAGG + Intergenic
919854261 1:201694957-201694979 CTCTACATTTGGAAGCAAGGAGG - Intronic
920296512 1:204960629-204960651 CTGGTGATATGGGAGCATGAAGG + Intronic
921800586 1:219398601-219398623 GTGGTCATTTGGAGGAATGAAGG + Intergenic
922430176 1:225543979-225544001 TCGTGCATTTGGAAGCGTGATGG - Intronic
923028102 1:230223095-230223117 CTGCTTATTTCTAAGCATGAGGG + Intronic
1064835295 10:19521088-19521110 CAGTTCATTTGGAATCTTGGAGG + Intronic
1065292014 10:24240057-24240079 CTGGTCACTTGGGAGTATGAGGG + Intronic
1066216851 10:33296548-33296570 CTGCTCAGCTGGAGGCATGAGGG + Intronic
1068701686 10:60026617-60026639 CTGTTCATTTGGTATCATCCTGG - Exonic
1069302886 10:66929882-66929904 CTGTTCATTTTGGAGGATGAAGG - Intronic
1069449792 10:68507385-68507407 CTCTTTATCTGGAAGGATGAAGG + Intronic
1070338779 10:75477829-75477851 CTGCTCATTTGCAAGAATTATGG + Intronic
1073764013 10:106662347-106662369 GAGTTTATTTGGAAGCATGCAGG - Intronic
1073899116 10:108198670-108198692 CTTTTCATTTGAAAGCATCTTGG - Intergenic
1074765486 10:116696947-116696969 CTGTCCATTGGGGAGCATCATGG - Intronic
1079119405 11:17671262-17671284 CTGATCATATGGATGCAGGATGG - Intergenic
1083988891 11:66234463-66234485 CTGTTCATCTGGAAGGAACAAGG + Intronic
1084912980 11:72406247-72406269 TTGTTCCCTTGGAGGCATGAGGG - Intronic
1086760193 11:90620323-90620345 GTCATCATTTGGAAGAATGAAGG - Intergenic
1087093174 11:94296271-94296293 CTTTTCATTTGTAAGCACAAGGG + Intergenic
1091401674 12:184953-184975 CATTTCATTAGGAAGTATGACGG - Intergenic
1094717342 12:33026015-33026037 CTGTTCATTTGGGAAAAGGATGG - Intergenic
1095190457 12:39251791-39251813 CTGTTGATTTGGAGGTATGAGGG - Intergenic
1095437989 12:42212421-42212443 GTGATTATTTAGAAGCATGATGG - Intronic
1098050401 12:66446834-66446856 CTATTCATTTTGAAGGAAGATGG - Intronic
1098678688 12:73322393-73322415 GTGGTCATTTGGAAGAAAGAAGG - Intergenic
1099477650 12:83126955-83126977 CTATTCATTTTTAAGCATCATGG + Intronic
1100349938 12:93770771-93770793 CTTTTCATTTGGAAATGTGAAGG - Intronic
1102358246 12:112259175-112259197 CTGTAAATTTGGATGCATCAAGG + Exonic
1102463900 12:113116855-113116877 CTGTTCATGTGCAAACATGTTGG - Intronic
1106461048 13:29969231-29969253 CTGATCTTTCGGAAGCATTATGG + Intergenic
1107054634 13:36089844-36089866 ATCTCCATTTGGCAGCATGAGGG + Intronic
1107776757 13:43852079-43852101 GTGGTCATTTGGAAGAAAGAAGG - Intronic
1111542558 13:89688567-89688589 CTGTTCCTTAGGGGGCATGAAGG - Intergenic
1112626771 13:101113930-101113952 CTGTTCATCAGGCAGCATGAGGG - Intronic
1113580654 13:111426289-111426311 CTGTACCTGGGGAAGCATGAGGG - Intergenic
1117400865 14:55357525-55357547 CTGTTTATTAAGAAGTATGAAGG + Intronic
1119031177 14:71193817-71193839 CTGATCATTTGCAGGCAGGATGG + Intergenic
1119125328 14:72120346-72120368 CAGTTCTTGTGGAATCATGATGG + Intronic
1120297754 14:82665289-82665311 CAGCCCATTTGGGAGCATGAGGG - Intergenic
1120987860 14:90349930-90349952 CTGTGCTTTTGGCAGCATGTTGG - Intergenic
1122189883 14:100033030-100033052 CTGTTCATTTCTAAGCATGAAGG + Intronic
1123470054 15:20543578-20543600 CTATTAACTTGGAAGGATGAAGG - Intergenic
1123648001 15:22457119-22457141 CTATTAACTTGGAAGGATGAAGG + Intergenic
1123730348 15:23138574-23138596 CTATTAACTTGGAAGGATGAAGG - Intergenic
1123748486 15:23335992-23336014 CTATTAACTTGGAAGGATGAAGG - Intergenic
1124280865 15:28359869-28359891 CTATTAACTTGGAAGGATGAAGG - Intergenic
1124301839 15:28551756-28551778 CTATTAACTTGGAAGGATGAAGG + Intergenic
1124562642 15:30789571-30789593 CTATTAACTTGGAAGTATGAAGG + Intergenic
1127034630 15:54901775-54901797 CAGTATACTTGGAAGCATGATGG - Intergenic
1127768315 15:62209462-62209484 CTGTTGTTTTGCAAGCAGGAGGG - Intergenic
1128277209 15:66363634-66363656 CTGGTCATTTAAAAGCATGCTGG + Intronic
1129474228 15:75773663-75773685 CTATTAACTTGGAAGTATGAAGG + Intergenic
1130594310 15:85238503-85238525 CTATTAACTTGGAAGGATGAAGG + Intergenic
1131224387 15:90611901-90611923 CTGGTCATTTGGCAGGATGTAGG - Intronic
1132184139 15:99789177-99789199 CTATTAACTTGGAAGTATGAAGG + Intergenic
1132434233 15:101783978-101784000 CTATTAACTTGGAAGTATGAAGG - Intergenic
1133081366 16:3323263-3323285 CTGTATTTTTGGTAGCATGATGG + Intergenic
1134352174 16:13447889-13447911 CCCTTCATTTGAACGCATGATGG + Intergenic
1137719221 16:50618168-50618190 CTGCTCATTTGGAAGAAAAAAGG - Intronic
1138800857 16:60027047-60027069 GTGTTCATTTGGAAGAATGCTGG + Intergenic
1141261527 16:82458766-82458788 CTCTGCATTTGGAAACATGGCGG + Intergenic
1144730174 17:17521500-17521522 CTTTTCATTTGACAGCAGGAAGG + Intronic
1144793681 17:17876819-17876841 ATGTCCATTTGAAAGCAAGAGGG + Intronic
1147996969 17:44365091-44365113 CTGTATTTTTGGTAGCATGACGG + Intergenic
1150926884 17:69541693-69541715 CTGTTCCTTTGGATTCATGTAGG - Exonic
1151912486 17:77093050-77093072 CTGTAGACTTGGAAGAATGAGGG + Intronic
1154251717 18:12750438-12750460 ATGATCATTTGGAAGCCTGCTGG + Intergenic
1155544049 18:26896603-26896625 CGATTCATATTGAAGCATGATGG + Intergenic
1155875549 18:31082575-31082597 CACTTCATTTGAAATCATGAGGG + Intronic
1156126101 18:33906816-33906838 CTGTTCATTTGGAACACTAAGGG - Intronic
1156279319 18:35619390-35619412 TTTTACATTTGTAAGCATGAAGG - Intronic
1157048519 18:44132372-44132394 TTATTCATTTGGATACATGAAGG + Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1165929843 19:39350353-39350375 CTCTTCATTCAGAAGCAGGATGG - Intronic
1167017638 19:46851294-46851316 CTGGTGATTTGGAAGGCTGAGGG - Intergenic
1167136703 19:47620701-47620723 CTGGTCATTTGGAAGCATGTGGG - Intronic
1168313675 19:55474290-55474312 CTGTTTACTTGTCAGCATGAGGG + Intergenic
926181972 2:10652665-10652687 TGGTTCATTTGGGAGAATGAGGG - Intronic
928550745 2:32368083-32368105 TTGTTCATTTAGAATCATCAGGG + Intronic
929259661 2:39851539-39851561 CTGCACATTTGGAGCCATGAGGG - Intergenic
929606627 2:43239083-43239105 GTGGTCATTTGGAATCATGTTGG + Intronic
930553682 2:52868877-52868899 GTGTTCATAGGGAAGGATGAGGG + Intergenic
932373895 2:71217493-71217515 CTATTAACTTGGAAGTATGAAGG - Intronic
933490056 2:82974540-82974562 CTGATCATGAAGAAGCATGAGGG - Intergenic
936697898 2:114972872-114972894 CAGTTCTTTTGGAAGGACGAAGG + Intronic
936822952 2:116545266-116545288 CTATTCCTTTGCAAGCCTGATGG + Intergenic
939567715 2:143804194-143804216 CCTCTCATATGGAAGCATGAGGG + Intergenic
941501525 2:166284498-166284520 CTGTCCATTGGGGAGCATGAGGG + Exonic
942438187 2:176003467-176003489 CTGTACACTTGCAAGGATGAGGG + Intergenic
944015529 2:195032151-195032173 CTGATGAGTTGGAAGCAGGATGG + Intergenic
944058855 2:195550402-195550424 GTGTTCATTTGGAAAGATCAGGG - Intergenic
945980885 2:216309691-216309713 CTCTCCATGTGGAAGCAAGATGG - Intronic
946331863 2:219014020-219014042 CTGGTCACTTGGAAGGAGGAAGG + Exonic
947536466 2:230942901-230942923 CTGTTCATTGGCAATGATGAAGG - Intronic
947924979 2:233913459-233913481 CTGTTCATTTGTAAGCTAGAGGG + Intergenic
1169721298 20:8679483-8679505 GTATGCATTTGCAAGCATGATGG + Intronic
1171996252 20:31733947-31733969 CTGTTCATTTGGAAGGAATTGGG + Intergenic
1173093164 20:39995703-39995725 CTGTTCATTTTATAGCAGGAGGG - Intergenic
1174125635 20:48303088-48303110 ATGTGCATATGGAAGGATGATGG - Intergenic
1175426889 20:58873358-58873380 GTTTTCACTTGGAACCATGATGG - Intronic
1178798576 21:35768835-35768857 CTCTTCATATGGCAGCAGGAAGG + Intronic
1180173103 21:46071041-46071063 CTGTGGATTTGGAAGCAAGAAGG + Intergenic
1181446910 22:22984044-22984066 CTGTCCTTTTGGAAGCAGCAAGG + Intergenic
953545944 3:43863646-43863668 CTGTTCATCTGGAATGCTGACGG - Intergenic
954559162 3:51541529-51541551 CTGTGGTTTTGGGAGCATGAAGG + Intronic
954806387 3:53223430-53223452 TTGTTCAGTGGGAATCATGACGG - Intergenic
956324270 3:68033914-68033936 CAGTTCATTTGGAAGAAATATGG + Intronic
958619535 3:96538814-96538836 CTATTTATTTGCAAGAATGAGGG - Intergenic
963469842 3:145726503-145726525 TTTTTAATTTGGAAGCATCATGG - Intergenic
964461987 3:156943054-156943076 TTTTTCATTTGGAAAAATGAAGG - Intronic
965465900 3:169030393-169030415 CTCTTCATATGGCAGCAGGAAGG + Intergenic
965562043 3:170071318-170071340 CTGGTCATTTAAAAGCATGTGGG + Intronic
966582579 3:181584795-181584817 CGGTTGATTGGGAAGCATCATGG + Intergenic
967140736 3:186556959-186556981 CAGTTCATTAACAAGCATGATGG + Intronic
970351106 4:15202611-15202633 CTCTCCACATGGAAGCATGAAGG + Intergenic
971331971 4:25689075-25689097 CTCTGCAACTGGAAGCATGAAGG + Intergenic
971519251 4:27528709-27528731 CTGCTCATGTGGAATCCTGAAGG + Intergenic
974711076 4:65596105-65596127 CTTTAAATTTGGAAGAATGAAGG - Intronic
978135603 4:105254775-105254797 CTCCTCCTATGGAAGCATGAAGG + Intronic
980164893 4:129213865-129213887 CTGTGAAATTGGCAGCATGATGG + Intergenic
980684148 4:136203409-136203431 TTGTTCATTTGCAGGCAGGATGG - Intergenic
980705253 4:136484805-136484827 CTGTTCATTTAGAGGTGTGAGGG + Intergenic
981119050 4:141027235-141027257 CTATTCCTTTTGAAGCAAGAAGG - Intronic
981145943 4:141324212-141324234 CTATTCATTTGGAAACAAGAAGG + Intergenic
981902382 4:149881629-149881651 ATGTTAATTTGGAAGTGTGAAGG - Intergenic
982437944 4:155399390-155399412 CTCTTCATGTGGCAGCCTGAGGG + Intergenic
987027731 5:13944514-13944536 CTTTCCATTTGGAAGCCTGTTGG - Exonic
988785225 5:34560532-34560554 GTGTTCATTTGGAAGAAACAGGG - Intergenic
993448517 5:88044663-88044685 CTGTCCATATGGAATCATTACGG + Intergenic
994014629 5:94951117-94951139 CTGGACAGTTGGAAGGATGAGGG - Intronic
994022094 5:95038964-95038986 CTTTTCTTTTGAAAGCAAGAAGG - Intronic
995956157 5:117778900-117778922 CTCTTCTTTTGGTAGCATGAAGG + Intergenic
997676833 5:135719551-135719573 CTCTTCATGTAGCAGCATGAGGG - Intergenic
1000310270 5:160036738-160036760 CTCTCCTTTTGGAAGCAGGATGG - Exonic
1000946091 5:167424756-167424778 CTGTTCAGCTTGGAGCATGAAGG + Intronic
1002608116 5:180395415-180395437 ATATTCATTTGGAAACATTATGG + Intergenic
1005976824 6:30806566-30806588 ATGGTCATGTGGAAGCATTATGG + Intergenic
1010377926 6:75194720-75194742 CTGTGCTTTAGGAAGCCTGAGGG - Intronic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1013858997 6:114610789-114610811 CTCTTCATATGGAGGCAGGAAGG - Intergenic
1015044680 6:128762877-128762899 GTGTTCATTTGGAGGTAAGAAGG - Intergenic
1020556372 7:9674950-9674972 CAGTTCTTTGGGCAGCATGATGG + Intergenic
1020592038 7:10151570-10151592 TTGTTCTTTTGGGAGCAGGATGG - Intergenic
1021497711 7:21294247-21294269 CTTTTCAGTGGGAAGCCTGAGGG - Intergenic
1022437742 7:30406235-30406257 ATTTTAATTTGGAAGCATCATGG + Intronic
1022452518 7:30528167-30528189 CTATTAACTTGGAAGTATGAAGG - Intronic
1031059956 7:117039965-117039987 GTTTTCATGTGCAAGCATGATGG - Intronic
1031078181 7:117232715-117232737 CTGGTCATTTAAAAGCATGTGGG - Intergenic
1032889676 7:136181168-136181190 TTGTTCATTTGGCAGGATGTGGG + Intergenic
1033526231 7:142216773-142216795 ATGTTCAATTGGCATCATGAAGG - Intronic
1034408779 7:150925226-150925248 TTGTTCATTTTGAACTATGAAGG - Intergenic
1036795182 8:11750533-11750555 CTGTTCATTTGGAAAACAGAAGG + Intronic
1037849437 8:22314615-22314637 CTGTTCATTTGGAAGCATGAGGG - Intronic
1038893526 8:31754781-31754803 CTATTCAAATGGAAGAATGAAGG + Intronic
1039808329 8:41022854-41022876 CAGTTCGTTTTGAAGCCTGAAGG - Intergenic
1041762706 8:61384288-61384310 CTGGACATATGGAAGCAAGATGG + Intronic
1042326072 8:67529191-67529213 TTGTTATTTTGGAAGCAAGATGG - Intronic
1042347940 8:67746908-67746930 CTGTACATTTGGAATCATTTAGG + Intergenic
1045376233 8:101577192-101577214 AAATTCATTTTGAAGCATGAAGG - Intronic
1046795243 8:118364585-118364607 CTGTGCATGTGAAAGCGTGAGGG - Intronic
1047458200 8:125036184-125036206 CTGTGTATCTGGAACCATGATGG - Intronic
1050672196 9:8010148-8010170 CAGTTCTTTTGGAAACATGCAGG - Intergenic
1053514061 9:38714740-38714762 CTGTTCATTTAGAAGTGTCAAGG + Intergenic
1054777717 9:69138081-69138103 CTGTTAAGTTGGAATCAGGATGG - Intronic
1056544071 9:87598683-87598705 CTGTTCACATGGGAGAATGAAGG - Intronic
1061998932 9:134206355-134206377 CTTTTCATTTGGACCCATTAGGG - Intergenic
1185953016 X:4457347-4457369 ATTTTCATTAGGAAGGATGATGG - Intergenic
1187248552 X:17575803-17575825 ATGTCTATTTGGAAGCATGAAGG + Intronic
1189678428 X:43487767-43487789 GTGGTCATTTGGAAGTAAGAAGG - Intergenic
1191075096 X:56444587-56444609 ATGTTCATTTGGAGGTAAGAAGG + Intergenic
1194751749 X:97693150-97693172 CAGTTCTTTAGGAAGGATGAAGG + Intergenic
1196573344 X:117289040-117289062 CTGTACCTTTGGAAACAGGAGGG + Intergenic
1201683259 Y:16672265-16672287 CTGTTTCTTTGGAGGCATCATGG - Intergenic
1202366068 Y:24166205-24166227 CTATTACTTTGGAAGTATGAAGG + Intergenic
1202374346 Y:24219839-24219861 CTATTAACTTGGAAGTATGAAGG - Intergenic
1202496435 Y:25450281-25450303 CTATTAACTTGGAAGTATGAAGG + Intergenic
1202504714 Y:25503918-25503940 CTATTACTTTGGAAGTATGAAGG - Intergenic