ID: 1037853223

View in Genome Browser
Species Human (GRCh38)
Location 8:22349950-22349972
Sequence AGAACCACTTCACTAACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037853223_1037853227 8 Left 1037853223 8:22349950-22349972 CCTTTGGTTAGTGAAGTGGTTCT No data
Right 1037853227 8:22349981-22350003 AGCAATTTTGTCCTCCCAGTGGG No data
1037853223_1037853226 7 Left 1037853223 8:22349950-22349972 CCTTTGGTTAGTGAAGTGGTTCT No data
Right 1037853226 8:22349980-22350002 GAGCAATTTTGTCCTCCCAGTGG No data
1037853223_1037853229 21 Left 1037853223 8:22349950-22349972 CCTTTGGTTAGTGAAGTGGTTCT No data
Right 1037853229 8:22349994-22350016 TCCCAGTGGGTGATATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037853223 Original CRISPR AGAACCACTTCACTAACCAA AGG (reversed) Intronic