ID: 1037853223 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:22349950-22349972 |
| Sequence | AGAACCACTTCACTAACCAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1037853223_1037853227 | 8 | Left | 1037853223 | 8:22349950-22349972 | CCTTTGGTTAGTGAAGTGGTTCT | No data | ||
| Right | 1037853227 | 8:22349981-22350003 | AGCAATTTTGTCCTCCCAGTGGG | No data | ||||
| 1037853223_1037853226 | 7 | Left | 1037853223 | 8:22349950-22349972 | CCTTTGGTTAGTGAAGTGGTTCT | No data | ||
| Right | 1037853226 | 8:22349980-22350002 | GAGCAATTTTGTCCTCCCAGTGG | No data | ||||
| 1037853223_1037853229 | 21 | Left | 1037853223 | 8:22349950-22349972 | CCTTTGGTTAGTGAAGTGGTTCT | No data | ||
| Right | 1037853229 | 8:22349994-22350016 | TCCCAGTGGGTGATATATAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1037853223 | Original CRISPR | AGAACCACTTCACTAACCAA AGG (reversed) | Intronic | ||