ID: 1037853229

View in Genome Browser
Species Human (GRCh38)
Location 8:22349994-22350016
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037853223_1037853229 21 Left 1037853223 8:22349950-22349972 CCTTTGGTTAGTGAAGTGGTTCT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1037853229 8:22349994-22350016 TCCCAGTGGGTGATATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr