ID: 1037855055

View in Genome Browser
Species Human (GRCh38)
Location 8:22366051-22366073
Sequence TAGGGTTATTACAAAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855048_1037855055 30 Left 1037855048 8:22365998-22366020 CCCAAACGGATGACATAATGTCT No data
Right 1037855055 8:22366051-22366073 TAGGGTTATTACAAAGATGAAGG No data
1037855051_1037855055 -1 Left 1037855051 8:22366029-22366051 CCGAGTTTAACCAAGAGAGAAAT No data
Right 1037855055 8:22366051-22366073 TAGGGTTATTACAAAGATGAAGG No data
1037855049_1037855055 29 Left 1037855049 8:22365999-22366021 CCAAACGGATGACATAATGTCTG No data
Right 1037855055 8:22366051-22366073 TAGGGTTATTACAAAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855055 Original CRISPR TAGGGTTATTACAAAGATGA AGG Intergenic
No off target data available for this crispr