ID: 1037855107

View in Genome Browser
Species Human (GRCh38)
Location 8:22366388-22366410
Sequence CTAAATTTGCGCAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855107_1037855114 -2 Left 1037855107 8:22366388-22366410 CCCCCTTCCCTGCGCAAATTTAG No data
Right 1037855114 8:22366409-22366431 AGAGACAGCTAGTGCCGTCTGGG No data
1037855107_1037855117 17 Left 1037855107 8:22366388-22366410 CCCCCTTCCCTGCGCAAATTTAG No data
Right 1037855117 8:22366428-22366450 TGGGGACCAGTCACTGTGCTAGG No data
1037855107_1037855113 -3 Left 1037855107 8:22366388-22366410 CCCCCTTCCCTGCGCAAATTTAG No data
Right 1037855113 8:22366408-22366430 TAGAGACAGCTAGTGCCGTCTGG No data
1037855107_1037855115 -1 Left 1037855107 8:22366388-22366410 CCCCCTTCCCTGCGCAAATTTAG No data
Right 1037855115 8:22366410-22366432 GAGACAGCTAGTGCCGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855107 Original CRISPR CTAAATTTGCGCAGGGAAGG GGG (reversed) Intergenic
No off target data available for this crispr