ID: 1037855405

View in Genome Browser
Species Human (GRCh38)
Location 8:22367613-22367635
Sequence CCCGCACCCTCCAGGCGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855405_1037855413 12 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855413 8:22367648-22367670 CAGAAGGGTGCCCAGAGCGTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
1037855405_1037855409 -4 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855409 8:22367632-22367654 CGGGATGCTAGAGCCGCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1037855405_1037855410 -3 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855410 8:22367633-22367655 GGGATGCTAGAGCCGCAGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 192
1037855405_1037855416 27 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855405_1037855412 11 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855412 8:22367647-22367669 GCAGAAGGGTGCCCAGAGCGTGG 0: 1
1: 1
2: 5
3: 25
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855405 Original CRISPR CCCGCACCCTCCAGGCGGAC AGG (reversed) Intronic
900618461 1:3576182-3576204 CCTCCACCCTCCGGGCAGACAGG + Intronic
902301362 1:15504979-15505001 CCAGCACTCTCCAGGCACACTGG - Intronic
902585786 1:17438109-17438131 CACGCTCCCTCCCGGCGGCCGGG - Intronic
905290861 1:36920928-36920950 CCCGCCCCCTCCATGCATACTGG + Intronic
906524444 1:46486047-46486069 CTCTCAACCTCCAGGCGGGCAGG - Intergenic
908195474 1:61742683-61742705 CCCACCCACTCCAGGCGGGCGGG - Intronic
919802487 1:201362014-201362036 CCCACACCCTCCAGACAGAGCGG - Exonic
920540576 1:206774803-206774825 CTCGCACCCTCCAGGCTTACAGG - Intergenic
921472657 1:215567523-215567545 CCCCCACCTTCCCGGCGGCCGGG - Exonic
924584634 1:245351151-245351173 TCCAGACCCTCCATGCGGACAGG - Intronic
1067068652 10:43117383-43117405 CCCGGACTCTCCAGGGGCACAGG + Intronic
1067300228 10:45001116-45001138 CCCGCCCCCGCCCGGCGGCCAGG - Intronic
1071532472 10:86400625-86400647 CCCTCACCTTCCAGGCGGGGAGG + Intergenic
1073253064 10:102133616-102133638 CCCTCCCCCTCTAGGCGGCCCGG + Intronic
1076882921 10:133248276-133248298 CCCGCAGCCTCCTGGCTCACAGG + Intergenic
1077652840 11:3989463-3989485 CACGCACCCTCCACGCCGCCAGG - Intronic
1081543452 11:44052739-44052761 ACCTCACTCTCCAGGTGGACAGG - Exonic
1081596646 11:44463954-44463976 CACGCACCCGCCATGGGGACAGG + Intergenic
1083318228 11:61829041-61829063 CCCGCACTCTCCATCCAGACTGG + Intronic
1084362786 11:68679820-68679842 CCAGCACACTCCAGGTGGAGGGG - Intergenic
1091375460 12:22241-22263 CCAGCAGCCTCTAGGGGGACTGG - Intergenic
1094624054 12:32106586-32106608 CCCGCCCCCGCGAGCCGGACAGG + Intergenic
1097172979 12:57127974-57127996 CCTGCACCTTCCCCGCGGACTGG + Intronic
1097872052 12:64610302-64610324 CCCGCCCCTTCCAGGCGCGCGGG - Intergenic
1112401843 13:99085398-99085420 CCCGCACCATCCAGGTGAATCGG + Intronic
1113960939 13:114125873-114125895 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113960949 13:114125911-114125933 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113960959 13:114125949-114125971 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113960969 13:114125987-114126009 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113960979 13:114126025-114126047 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113960989 13:114126063-114126085 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113960998 13:114126101-114126123 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113961007 13:114126139-114126161 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113961016 13:114126177-114126199 CTCGCACCCTCCAGAGGTACCGG + Intronic
1113961025 13:114126215-114126237 CTCGCACCCTCCAGAGGTACCGG + Intronic
1115752425 14:36505869-36505891 CCCCCACCCTCCAGGCTGCTTGG - Intronic
1119261029 14:73238034-73238056 CGCGCACCCCCGAGGCGGAGAGG - Intronic
1121555235 14:94831520-94831542 CCTGCACCCTCCAGGGTGGCTGG - Intergenic
1122228466 14:100293075-100293097 CCCGGGCCCTCCACGCGGAAGGG + Intronic
1122892973 14:104741578-104741600 CCCTCACCCCCGAGGCGGCCTGG + Intronic
1125664247 15:41417454-41417476 CCCGCACACTCCAGGAAGACGGG - Intronic
1132753024 16:1467569-1467591 CCCCCACCTCCCAGGTGGACAGG + Intronic
1132855859 16:2044273-2044295 CCCTCACCCTCCAGGAGCCCTGG - Intronic
1132878118 16:2149185-2149207 CCCCCACCCCCCAGGCGGCATGG + Intronic
1132997463 16:2830595-2830617 CCCCACCCCTCCAGGCAGACAGG - Intronic
1139437287 16:66943558-66943580 CGCCCACCCTCCAGGTAGACTGG - Intronic
1142211746 16:88811735-88811757 CCCGCGACCTCCGGGCGGGCGGG - Intronic
1142307279 16:89292875-89292897 CCTGCACCCTCCATGCTGCCCGG + Intronic
1142876092 17:2853019-2853041 CCCGCTTCCTCCTGGCGGGCCGG - Intronic
1144500562 17:15783065-15783087 GCCGCACCTGCCAGGCCGACGGG + Intergenic
1148783611 17:50134805-50134827 CCCCCACCCCCCAGGCGGGAGGG + Exonic
1150492307 17:65582927-65582949 CCATCTCCCTCCAGGCAGACAGG + Intronic
1152484183 17:80578921-80578943 CCAGCACCCTCCAGGGAGGCTGG - Intronic
1152689401 17:81711243-81711265 CCCCCACCCTCCAGGGCGAAGGG - Intergenic
1160034566 18:75288113-75288135 CCCGCAAGCTCGAGGCGAACTGG - Exonic
1160157388 18:76443962-76443984 CCCACTCCCTCCAGGCACACAGG + Intronic
1160763598 19:797635-797657 CCCGCGCCCGCCACGCGGAGAGG - Intronic
1161197174 19:2993445-2993467 CCCACAGCCCCCAGGAGGACTGG + Exonic
1161361963 19:3855541-3855563 GCAGCACCCTCCTGGAGGACGGG - Intronic
1161407572 19:4099075-4099097 TCGGCACCATCCAGGGGGACAGG + Intronic
1162735695 19:12745780-12745802 CCTGCACCATCCAGGCAGCCGGG + Intronic
1163291501 19:16382085-16382107 GCCTAACCCTCCAGGCTGACCGG + Intronic
1163592889 19:18204251-18204273 CCCGCCTCCCCGAGGCGGACAGG - Intergenic
1163720136 19:18894871-18894893 CCTGCACCCTCCAGCCAGACGGG + Intronic
1164159407 19:22616864-22616886 TCCCAGCCCTCCAGGCGGACTGG - Intergenic
1164905790 19:31966875-31966897 CTCACACCCTACAGGCGGAAAGG + Intergenic
1167486590 19:49766715-49766737 CCCGCCCCCTCCGCGCGGCCAGG - Intergenic
925979335 2:9164291-9164313 CCCCCACCCTCCTGGCACACTGG - Intergenic
926233588 2:11023050-11023072 TCCTCACCCTCCAGGTGGGCCGG - Intergenic
932197640 2:69798068-69798090 CCAGCACTGTCCAGTCGGACCGG - Intronic
934797359 2:97113080-97113102 CGCGCACCCTCCGGCCGGATGGG + Intergenic
1169084074 20:2816207-2816229 CACGGACCCTCCAGGCTGGCAGG - Intergenic
1170562685 20:17570325-17570347 CCCGGACACTGCAGCCGGACCGG - Intronic
1170972118 20:21125993-21126015 CCCGCCTCCTGCAGGCGGCCCGG + Intronic
1172036992 20:32018160-32018182 CCCGCCCCCTCCCGCCGCACCGG - Exonic
1172661724 20:36573429-36573451 CCCGCCCCCTCCGGGCGCGCTGG + Intergenic
1174173784 20:48632531-48632553 GCCCCACCCTCCAGGCGGGAGGG + Exonic
1175856083 20:62121923-62121945 CCCTCACCCTCATGGGGGACCGG - Intergenic
1180876695 22:19178232-19178254 CCCGGTCCCTGCAGGCGGCCTGG - Exonic
1185084591 22:48733286-48733308 GCCCTACCCTCCAGGCTGACTGG - Intronic
1185140745 22:49099841-49099863 CCCACAGCCTCCAGGAGGACTGG - Intergenic
1185392665 22:50571076-50571098 CCCTGGCCCTCCAGGCAGACAGG + Intronic
953526074 3:43691077-43691099 CGCGCACCCTCCGCGCGGGCCGG + Intronic
954758202 3:52854362-52854384 CCCCCACCCTCCAGGGAGAAGGG + Intronic
955251477 3:57287340-57287362 CCCTTACCCTCCAGGCTGCCGGG - Intronic
960080094 3:113532489-113532511 CGCGCACCCTCTTGGGGGACGGG + Exonic
961769805 3:129240670-129240692 TCCCCACCCTCCAGGAGGACCGG - Intergenic
973996922 4:56467775-56467797 GCCGCATCCTCCAGCCGGCCTGG - Intronic
984890676 4:184489908-184489930 CCAGCACCTTCCAGGCCGGCTGG + Intergenic
988623958 5:32851276-32851298 CCCTCACCCTCCTGCCGCACTGG - Intergenic
997425912 5:133802513-133802535 CCAGCGCCCTGCAGGCTGACTGG - Intergenic
998132711 5:139659450-139659472 CCCGCACACTGCAGGAGGGCTGG + Intronic
1002462327 5:179380599-179380621 CCCATACCCGCCAGGCCGACAGG + Intergenic
1002927174 6:1611289-1611311 TCCGCACCGTCCAGGCTGAGCGG - Exonic
1007930554 6:45687006-45687028 CCCTCACCCACCAGGAGAACGGG - Intergenic
1013432374 6:110066540-110066562 CCTGCACTCTCCAGGCAGAATGG - Intergenic
1014233866 6:118934516-118934538 CCCGCCCCCTCCGCGCGGGCTGG + Intronic
1015707502 6:136104047-136104069 CCCTCACCCTCCCTGAGGACAGG - Intronic
1019157913 6:170051384-170051406 CACGGACCCTCCAGGGAGACAGG + Intergenic
1019448127 7:1081924-1081946 CCCCCACCCACCAGGTGGCCAGG + Intronic
1019707801 7:2504826-2504848 CCCGCAGCCCCCAGGAGGCCGGG - Intergenic
1023354563 7:39354020-39354042 CCCGCCCGCTCCAGGCGGCCCGG + Intronic
1027901192 7:84117435-84117457 TCCCCAACCTCCAGGCAGACTGG + Intronic
1032441398 7:131945466-131945488 CCCGCACCCTCCAGAGAAACCGG - Intergenic
1033033270 7:137846967-137846989 CCCGCACCCTCCAGCCCCGCCGG + Intronic
1037855405 8:22367613-22367635 CCCGCACCCTCCAGGCGGACAGG - Intronic
1037989551 8:23311158-23311180 CCCTCCCCCTCCAGGCTTACAGG + Intronic
1038828603 8:31033317-31033339 CCCGCACCCGCCAGGAGGGGAGG + Exonic
1045311958 8:101010540-101010562 CCTGCAGCCTCCAGGAGGAGCGG - Intergenic
1045429876 8:102103592-102103614 CCACCACCCTCCAGGCTGAGTGG - Intronic
1046795841 8:118370777-118370799 CCCTCACCCTCCACCCTGACAGG - Intronic
1047697211 8:127415899-127415921 CTCGCCCCCTCCAGGCGGTGGGG + Exonic
1049680380 8:143915460-143915482 CCTGGACCCACCAGGAGGACAGG + Exonic
1049787360 8:144457413-144457435 CCCACACCCAACAGGCAGACAGG + Intronic
1049791837 8:144475785-144475807 CCTGCACCCTCCACCCGGCCAGG - Exonic
1049988274 9:971637-971659 CCCTAACCCGCCCGGCGGACGGG - Intergenic
1052831743 9:33221405-33221427 CCTGAACCCTCCAGGCACACTGG + Intronic
1060555658 9:124506070-124506092 CCCGAGGCCTCCAGGCGGGCGGG - Intronic
1060730117 9:126031639-126031661 TCCCCACCCTCCAGGCGGATTGG + Intergenic
1060930470 9:127486533-127486555 CCCGCACAGTCCAGGCGCCCTGG - Intronic
1060974283 9:127755321-127755343 ACCCCACCCTCCAGCCGGCCAGG + Intronic
1061033653 9:128101683-128101705 CCCGCCCCCTCCACACGCACAGG - Intronic
1061260916 9:129480672-129480694 TGCGCTCCCTCCAGGTGGACGGG + Intergenic
1061798751 9:133103077-133103099 CCCTCACCCTCCAGTGGGAGGGG + Intronic
1061843738 9:133375650-133375672 CCCCCACCCTCCAGCCAGCCCGG - Intronic
1061974698 9:134062261-134062283 GCCGGGCCCTCCAGGCGGCCAGG - Intronic
1189160323 X:38803904-38803926 GCCCCACCCTCCAGTCGGTCCGG + Exonic
1189317188 X:40064436-40064458 GCCCCACCCTCCGGGTGGACAGG - Exonic
1200093628 X:153647300-153647322 CCCGCCCTCTCCTGGCGGCCAGG + Exonic