ID: 1037855407

View in Genome Browser
Species Human (GRCh38)
Location 8:22367618-22367640
Sequence AGCATCCCGCACCCTCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855407_1037855410 -8 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855410 8:22367633-22367655 GGGATGCTAGAGCCGCAGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 192
1037855407_1037855412 6 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855412 8:22367647-22367669 GCAGAAGGGTGCCCAGAGCGTGG 0: 1
1: 1
2: 5
3: 25
4: 219
1037855407_1037855413 7 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855413 8:22367648-22367670 CAGAAGGGTGCCCAGAGCGTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
1037855407_1037855409 -9 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855409 8:22367632-22367654 CGGGATGCTAGAGCCGCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1037855407_1037855416 22 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855407 Original CRISPR AGCATCCCGCACCCTCCAGG CGG (reversed) Intronic
900296671 1:1955369-1955391 CGCAGCCCGGCCCCTCCAGGGGG + Intronic
902557964 1:17258201-17258223 TGCATGCCGCTGCCTCCAGGAGG + Intronic
902920868 1:19665376-19665398 TGCCGCCCGCCCCCTCCAGGGGG + Exonic
902987098 1:20161580-20161602 AGCTTCCCTCATCCTCCAGGAGG + Intronic
905044552 1:34985409-34985431 ACCGTCCCCCACCCTCCAGGGGG + Intronic
906495282 1:46301318-46301340 AGCATCCCAGAAGCTCCAGGCGG + Intronic
906616157 1:47234243-47234265 AGTATCCAGAACCTTCCAGGTGG + Intergenic
910570725 1:88699574-88699596 GTCATCCCCCACCCTCCAGTAGG + Intronic
911367351 1:96954475-96954497 AGCATCCTGGACTATCCAGGTGG - Intergenic
916007697 1:160677317-160677339 AGTATCCTGCATCCTACAGGTGG - Intergenic
919991559 1:202710892-202710914 AGAAGCCCCCACCATCCAGGTGG - Intergenic
924644729 1:245867117-245867139 AGTATCCCGGACTTTCCAGGTGG + Intronic
1062844718 10:695466-695488 TGCAGCGCACACCCTCCAGGAGG - Intergenic
1063987020 10:11515444-11515466 AGGTTCCCACAACCTCCAGGAGG - Intronic
1067474114 10:46555427-46555449 GGGATACAGCACCCTCCAGGAGG + Exonic
1071310837 10:84342067-84342089 CCCATCCCCCAACCTCCAGGGGG - Intronic
1071565260 10:86668338-86668360 GGCACCCAGCACCCCCCAGGGGG - Intergenic
1072429285 10:95356585-95356607 AAGATCCCGCACACTCGAGGAGG + Intronic
1076395911 10:130136962-130136984 AGCCTGCCGCTCCCTCCCGGCGG - Intronic
1076726868 10:132418055-132418077 TGCATCTCGCTGCCTCCAGGTGG + Intergenic
1077303287 11:1856806-1856828 AGCATTGCACATCCTCCAGGTGG - Intronic
1077922092 11:6649265-6649287 AGCATCCCGAGCCCTCCAGCAGG - Intronic
1079075022 11:17379577-17379599 AGCATCTCTCATCCTCCAGCAGG - Intergenic
1080615147 11:33939258-33939280 AGCATCCTGGATCATCCAGGTGG + Intergenic
1084553366 11:69862287-69862309 AGCAACCTGCACCCACCAAGGGG - Intergenic
1084860638 11:72015700-72015722 CGCATCCCGCTCCCTTAAGGAGG + Exonic
1089318663 11:117610065-117610087 AGCAACCTGCCCCCTCGAGGAGG + Intronic
1091195992 11:133731139-133731161 AGCTTCTCTCACCCTTCAGGAGG + Intergenic
1096548790 12:52359003-52359025 AGCAGCCAGCAGCCTCCAGTGGG + Intergenic
1096598910 12:52715578-52715600 TGCATTCCTCGCCCTCCAGGAGG + Intergenic
1101961388 12:109253232-109253254 AGCCTCCCACACCACCCAGGAGG - Intronic
1104364796 12:128167137-128167159 AGTATCCTGGACCGTCCAGGTGG - Intergenic
1105704834 13:22962387-22962409 AGCAGCCCCCACCCTCCATGGGG + Intergenic
1105857795 13:24387545-24387567 AGCATTCCCCACCCTCCATGGGG + Intergenic
1106082527 13:26512259-26512281 AGCATCTCTAACCCTCGAGGGGG + Intergenic
1111100091 13:83572216-83572238 CCCATCCTCCACCCTCCAGGAGG + Intergenic
1117897828 14:60506737-60506759 CGCAGCCCGCACCCTTCTGGCGG + Intronic
1118753945 14:68824658-68824680 TGCACCCCACCCCCTCCAGGAGG - Intergenic
1118887462 14:69879138-69879160 AGCAGCCGGCACCCACCAGAAGG - Intronic
1119260506 14:73235609-73235631 AGCTTCCCCCACCCTGCAGCGGG + Intergenic
1122541412 14:102499690-102499712 CACATCCCGCCCCCTCCCGGAGG + Exonic
1122970175 14:105149317-105149339 GGCACCCCCCACCCTGCAGGTGG - Exonic
1124146286 15:27128304-27128326 GGCATCCAGCACCCTCCACAAGG - Intronic
1127084087 15:55408456-55408478 AGCTTCCCGCAGCCGCCCGGCGG - Intronic
1127556920 15:60096511-60096533 ACGATCCCGAGCCCTCCAGGTGG - Intergenic
1128972461 15:72119195-72119217 AGCCTCCCTCACCCTCGAAGAGG - Intronic
1132155032 15:99489629-99489651 AGCATCCTGGACTGTCCAGGTGG - Intergenic
1132543923 16:524459-524481 AGAAGCCTGCACCCCCCAGGAGG + Intergenic
1145261263 17:21356064-21356086 AGCCTTCCTCAGCCTCCAGGAGG - Intergenic
1146789800 17:35744915-35744937 AGCAGCCCCCAACCTCCAGAGGG - Exonic
1148131510 17:45265091-45265113 AGCTGGCCCCACCCTCCAGGAGG - Intronic
1152791259 17:82281331-82281353 AGCTTCCAGCAGCTTCCAGGGGG + Intergenic
1152803710 17:82344570-82344592 GCCACCCCGCACCCACCAGGAGG - Intergenic
1153396800 18:4631423-4631445 AGCACCCCACAGCCTCCTGGTGG + Intergenic
1156520486 18:37718022-37718044 AGCATCCCGATCCATACAGGAGG + Intergenic
1161268967 19:3378952-3378974 AGCAGCCCTCAACCTCCAGGCGG + Intronic
1161976011 19:7608016-7608038 AGCTTCCCGCCCCCTCATGGCGG + Intronic
1163856148 19:19703805-19703827 AGCATCTCTCACCATGCAGGAGG - Intergenic
1164531923 19:29055351-29055373 AGCACCCCGTACCCTCAAGTGGG - Intergenic
1164708756 19:30339637-30339659 GGCAACCCTCACCCTCGAGGTGG - Intronic
1167363747 19:49044124-49044146 AGCATCCTACAACCTCCTGGTGG + Exonic
1167364750 19:49048803-49048825 AGCATCCTACAACCTCCTGGTGG - Exonic
1167366039 19:49055439-49055461 AGCATCCTACAACCTCCTGGTGG - Exonic
1167830318 19:52014711-52014733 AGCACCCCTCCCCTTCCAGGAGG + Exonic
1168260543 19:55191618-55191640 TCCAGCCCCCACCCTCCAGGCGG + Intronic
925191902 2:1891990-1892012 GGCCTCCCCCACCCGCCAGGTGG + Intronic
925745461 2:7039753-7039775 AGCATCGCGCTTCCTCTAGGTGG - Exonic
926233591 2:11023055-11023077 ACCACTCCTCACCCTCCAGGTGG - Intergenic
944242455 2:197499689-197499711 CGCCGCCCGCACCCTCCAGCTGG + Intronic
946551620 2:220807830-220807852 AGCATCCTGGGCTCTCCAGGTGG + Intergenic
1170588380 20:17752666-17752688 AGAAACTCTCACCCTCCAGGAGG - Intergenic
1171451031 20:25236580-25236602 AGCATCCTGCCTGCTCCAGGAGG + Intergenic
1172097348 20:32466930-32466952 AGCAGCCCTCTCCCACCAGGAGG - Intronic
1173188527 20:40859208-40859230 AGCCTCTCCCACCCTCCAGTAGG + Intergenic
1175127726 20:56764863-56764885 AGCAGCCGCCAGCCTCCAGGAGG - Intergenic
1175692715 20:61077029-61077051 ATCATCCTGTATCCTCCAGGTGG - Intergenic
1176171782 20:63699471-63699493 AGGAGCCTCCACCCTCCAGGAGG + Exonic
1176307932 21:5134002-5134024 TGCCTCGCGCACCCTCCCGGGGG + Exonic
1178878454 21:36430222-36430244 AGCTTCACGCAGCCTCTAGGCGG - Intergenic
1179849129 21:44128028-44128050 TGCCTCGCGCACCCTCCCGGGGG - Exonic
1180248080 21:46561867-46561889 AGCCCCCAGCACCCTCCACGGGG - Intronic
1180840052 22:18954947-18954969 AGGCTCCGGCACCTTCCAGGTGG + Intergenic
1181061853 22:20285541-20285563 AGGCTCCAGCACCTTCCAGGTGG - Intergenic
1181314852 22:21964413-21964435 AGCCACCGTCACCCTCCAGGAGG - Intronic
1182133145 22:27873726-27873748 AGCATCCAGTACCTTCCAGTTGG + Exonic
1182502178 22:30755735-30755757 CGCAGCCCCCACCCTCCAAGAGG + Intronic
1183647577 22:39135287-39135309 TGCACCCCGACCCCTCCAGGGGG + Intronic
1184294812 22:43516603-43516625 AGCTTCTCTCACCTTCCAGGAGG - Intergenic
1184520559 22:44991558-44991580 AGCATCACTCACCATCTAGGGGG - Intronic
950217660 3:11170741-11170763 GGCATACCTCATCCTCCAGGGGG - Intronic
950507457 3:13404032-13404054 AGCTGCCTGCAGCCTCCAGGAGG - Intronic
951908740 3:27728598-27728620 TGCCTTCCGCCCCCTCCAGGCGG + Intergenic
952372655 3:32738174-32738196 ACCACCCTCCACCCTCCAGGAGG - Intronic
954810682 3:53245453-53245475 AGGCTCCCTCACCCTCCAGATGG + Intronic
958464565 3:94442407-94442429 AGCAACCCGCTCTCACCAGGGGG + Intergenic
961470363 3:127107563-127107585 AGCAGCCTCCACCTTCCAGGAGG + Intergenic
961769806 3:129240675-129240697 AGCTCTCCCCACCCTCCAGGAGG - Intergenic
964032351 3:152152691-152152713 AGCCTCCCACCCCCTCCATGGGG + Intergenic
968801289 4:2744730-2744752 AGCATCCCGGGCCGTCCTGGAGG + Exonic
969266592 4:6068040-6068062 AGCATCAGGGACCCTCCTGGGGG + Intronic
970285450 4:14508137-14508159 AGCATACCTCTCCCTCTAGGTGG - Intergenic
971499854 4:27306910-27306932 AGTATCTCCCACCCTCGAGGTGG - Intergenic
977356948 4:95957908-95957930 AGCCTCCCTAACCCTCCAGAAGG - Intergenic
985538707 5:478102-478124 AGCATCCTGCACACTGAAGGCGG - Intronic
985562727 5:599334-599356 TCCATCCCCAACCCTCCAGGAGG + Intergenic
992688787 5:79223226-79223248 AGCATCCTGGACTATCCAGGTGG + Intronic
996185122 5:120464982-120465004 AGCATCTTGCACGCTCCAGCCGG - Intronic
1001548702 5:172586871-172586893 CCCATCCCGCACCCTCCAGAGGG - Intergenic
1001943368 5:175756740-175756762 AGGTGCCCACACCCTCCAGGTGG + Intergenic
1005933485 6:30500701-30500723 AGCATCCCACAGCCACCAGTGGG - Intergenic
1007760912 6:44133338-44133360 AGCATCCCTTAGCCCCCAGGGGG - Intronic
1010969325 6:82247464-82247486 AGCCACCCGCACCCTCCAGAAGG + Intronic
1016534314 6:145093280-145093302 GGCTTCCCGCAGGCTCCAGGGGG - Intergenic
1016750315 6:147624388-147624410 AGCAAAACGCACACTCCAGGTGG - Intronic
1018899539 6:168044239-168044261 AGCACCCCTCACCCTCCGGGAGG - Intronic
1018899563 6:168044322-168044344 AGCACCCCTCACCCTCCGGGAGG - Intronic
1018899638 6:168044577-168044599 AGCACCCCTCACCCTCCGGGAGG - Intronic
1019088296 6:169502087-169502109 AGCATCCCGCAGCCCCGGGGCGG - Intronic
1019593027 7:1845051-1845073 TGCCTCCCGCGCCCGCCAGGTGG - Intronic
1020270326 7:6590760-6590782 CTCATCCTGAACCCTCCAGGAGG + Intronic
1021574272 7:22093372-22093394 AGCATCCAGGACTATCCAGGTGG - Intergenic
1022534127 7:31085245-31085267 AGCATTTCACACCCTCCATGTGG - Intronic
1032852018 7:135803224-135803246 ATGATCCCTCATCCTCCAGGAGG - Intergenic
1033290529 7:140079162-140079184 TGCAGCCTGCAGCCTCCAGGGGG - Intergenic
1034306580 7:150048763-150048785 ACCACCCCGCGCCCTCCTGGTGG - Intergenic
1034800266 7:154051880-154051902 ACCACCCCGCGCCCTCCTGGTGG + Intronic
1037504523 8:19516800-19516822 AGCATCTCACCCCCTCCTGGGGG - Intronic
1037855407 8:22367618-22367640 AGCATCCCGCACCCTCCAGGCGG - Intronic
1038333165 8:26625473-26625495 AGCTCCCAGCACCCCCCAGGTGG + Intronic
1040908876 8:52497952-52497974 ATCCTCCCCCACCCCCCAGGTGG - Intergenic
1041108922 8:54467388-54467410 CGCATCCGGCGCCTTCCAGGTGG + Intergenic
1042200300 8:66274784-66274806 AGCCACCGGCACCCTCCAGATGG + Intergenic
1043344810 8:79286784-79286806 ACTCTCCAGCACCCTCCAGGTGG - Intergenic
1045311961 8:101010545-101010567 TGCCTCCTGCAGCCTCCAGGAGG - Intergenic
1046102774 8:109633645-109633667 ACCCTACCCCACCCTCCAGGTGG - Intronic
1047609539 8:126507629-126507651 TGCACCCCCCACCCTCCAGTAGG - Intergenic
1047910209 8:129519218-129519240 GGCATCCAGCACCCTCCTAGTGG + Intergenic
1048201004 8:132373928-132373950 AGCATCCACCACCCTCCCCGAGG + Intronic
1051827004 9:21232577-21232599 AGCAGCCCACACCCTGCCGGTGG - Intronic
1059415141 9:114157525-114157547 AGCAGCCAGCAGCCTCCTGGTGG + Intronic
1060730116 9:126031634-126031656 TGCTTTCCCCACCCTCCAGGCGG + Intergenic
1061859022 9:133458676-133458698 AGCACCCTGCACCCTCCCCGAGG + Intronic
1062433737 9:136536948-136536970 AGCATCCCTTAGCCCCCAGGAGG - Intronic
1062601817 9:137321787-137321809 AGCAGCCCGTACCCTCCACCGGG + Intronic
1186894895 X:13995780-13995802 AGCATCCTGTATCCTCCAAGTGG - Intergenic
1192209957 X:69121699-69121721 AGCACCCCTCAGCCTCAAGGAGG - Intergenic