ID: 1037855407

View in Genome Browser
Species Human (GRCh38)
Location 8:22367618-22367640
Sequence AGCATCCCGCACCCTCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855407_1037855413 7 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855413 8:22367648-22367670 CAGAAGGGTGCCCAGAGCGTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
1037855407_1037855410 -8 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855410 8:22367633-22367655 GGGATGCTAGAGCCGCAGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 192
1037855407_1037855412 6 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855412 8:22367647-22367669 GCAGAAGGGTGCCCAGAGCGTGG 0: 1
1: 1
2: 5
3: 25
4: 219
1037855407_1037855416 22 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855407_1037855409 -9 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855409 8:22367632-22367654 CGGGATGCTAGAGCCGCAGAAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855407 Original CRISPR AGCATCCCGCACCCTCCAGG CGG (reversed) Intronic