ID: 1037855408

View in Genome Browser
Species Human (GRCh38)
Location 8:22367621-22367643
Sequence TCTAGCATCCCGCACCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855408_1037855416 19 Left 1037855408 8:22367621-22367643 CCTGGAGGGTGCGGGATGCTAGA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855408_1037855417 29 Left 1037855408 8:22367621-22367643 CCTGGAGGGTGCGGGATGCTAGA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1037855417 8:22367673-22367695 GCCGCGCCGAAGGCTGAGCCAGG 0: 1
1: 0
2: 1
3: 29
4: 1064
1037855408_1037855412 3 Left 1037855408 8:22367621-22367643 CCTGGAGGGTGCGGGATGCTAGA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1037855412 8:22367647-22367669 GCAGAAGGGTGCCCAGAGCGTGG 0: 1
1: 1
2: 5
3: 25
4: 219
1037855408_1037855413 4 Left 1037855408 8:22367621-22367643 CCTGGAGGGTGCGGGATGCTAGA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1037855413 8:22367648-22367670 CAGAAGGGTGCCCAGAGCGTGGG 0: 1
1: 0
2: 1
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855408 Original CRISPR TCTAGCATCCCGCACCCTCC AGG (reversed) Intronic
900314152 1:2048774-2048796 TCTCCCATCCCTCGCCCTCCTGG - Intergenic
902920865 1:19665373-19665395 TCTTGCCGCCCGCCCCCTCCAGG + Exonic
905044549 1:34985406-34985428 GCTACCGTCCCCCACCCTCCAGG + Intronic
909175924 1:72358515-72358537 TCTATCATCCCACTCCCTTCTGG - Intergenic
910652066 1:89580499-89580521 TCTACCATCCCTCACACCCCTGG + Intronic
915778821 1:158522396-158522418 TATATCATCCCACACCATCCGGG - Intergenic
919896031 1:202010360-202010382 TCTGTCATCCCGCACCCTCTGGG - Exonic
924015664 1:239718992-239719014 TCTAGCATCTTGCATCTTCCTGG - Intronic
1070923498 10:80203767-80203789 CCTAGCATTCTCCACCCTCCTGG - Intronic
1071956871 10:90770130-90770152 TCTAGCATACCGCACCTGCGGGG + Intronic
1075092230 10:119450319-119450341 TCTACCTTCCAGCACACTCCAGG + Intronic
1077875610 11:6302476-6302498 TCTAGCAGGCCGCGCCTTCCAGG - Intergenic
1080804698 11:35641768-35641790 TCTAGCACCCAGCGTCCTCCTGG + Intergenic
1083445862 11:62707678-62707700 TCTAGCATCCTTCATCCTTCAGG + Exonic
1089462817 11:118662671-118662693 TCTAACATCTCGCCTCCTCCAGG - Intronic
1089616139 11:119695859-119695881 TCCAGGATCCAGGACCCTCCTGG - Intronic
1096609053 12:52789243-52789265 TCCAGCAGCCCGCACTTTCCCGG + Intergenic
1099081217 12:78183988-78184010 TCTAGCATTCCTCAGCCTTCTGG + Intronic
1103606518 12:122090008-122090030 TCTTGCATCCTCCACCCTCATGG - Intronic
1108350344 13:49585642-49585664 CCGAGCATCCCGCACCGCCCCGG + Intergenic
1113707917 13:112446103-112446125 GCCAGCATCCCACCCCCTCCAGG + Intergenic
1113768707 13:112895480-112895502 CCCAGCATCCAGCACCCACCTGG - Intronic
1113954837 13:114093376-114093398 TATATCATCCCACTCCCTCCTGG + Intronic
1116584624 14:46687058-46687080 TCTAGAATCCAGCACCCCACAGG - Intergenic
1124616240 15:31244464-31244486 TCTAGCATCCCTCCTGCTCCTGG + Intergenic
1125425892 15:39549137-39549159 TTAAGCATCCCGCATCCTCCAGG + Intergenic
1132744115 16:1429662-1429684 GGTAGCATCCAGAACCCTCCTGG + Intergenic
1138712391 16:58984204-58984226 TCTATCATCCCACTCTCTCCTGG - Intergenic
1141390821 16:83661927-83661949 TGAAGCATCCCTCAACCTCCTGG - Intronic
1142230024 16:88895723-88895745 TGTAGCATCCCCCGCCCTCCTGG - Intronic
1146411837 17:32592653-32592675 TCTGGCATCCCCTCCCCTCCTGG - Intronic
1147166337 17:38595632-38595654 TCTCCCATCCCCCACCCTCTGGG + Intronic
1148116110 17:45176061-45176083 TTTAGGATCCTGCATCCTCCAGG + Intergenic
1151274677 17:73025174-73025196 GCCAGCCTCCCCCACCCTCCTGG + Intronic
1151807946 17:76418238-76418260 TCTAGGAGCCCACAGCCTCCCGG + Intronic
1152689407 17:81711251-81711273 TCCGGCCTCCCCCACCCTCCAGG - Intergenic
1153897127 18:9574669-9574691 TCTATCATCCAGTAGCCTCCCGG - Intronic
1157794197 18:50559903-50559925 TCTGCCCTCCCGCAGCCTCCAGG - Intergenic
1160437525 18:78862884-78862906 ACCACCATCCCCCACCCTCCAGG - Intergenic
1161025479 19:2034869-2034891 TCTTGCCTCCAGCCCCCTCCAGG + Intronic
1161081061 19:2310385-2310407 GCTGGCATCCCTCACCCTCCAGG - Intronic
1161268965 19:3378949-3378971 TCCAGCAGCCCTCAACCTCCAGG + Intronic
1162762432 19:12896665-12896687 TCTGGCATCCGTCAGCCTCCTGG + Intronic
1163508966 19:17724227-17724249 CCCAGCAGCCCGCCCCCTCCAGG - Intronic
1167268189 19:48493634-48493656 TCTAGGCTCCTGCTCCCTCCAGG + Intronic
1167364752 19:49048806-49048828 TCCAGCATCCTACAACCTCCTGG - Exonic
1167366041 19:49055442-49055464 TCCAGCATCCTACAACCTCCTGG - Exonic
1167368812 19:49068675-49068697 TCTGCCATACCCCACCCTCCAGG + Exonic
925440518 2:3881312-3881334 TCTAGTACTCCACACCCTCCCGG - Intergenic
930252404 2:49049506-49049528 TCTAATATCCCCCACCCTCTTGG - Intronic
935763748 2:106344472-106344494 GCTAGCAGCCAGCCCCCTCCTGG + Intergenic
935854111 2:107256486-107256508 TCTAGCATCCCGGTCCTTCTGGG + Intergenic
944529865 2:200656727-200656749 CCAAGAATCCCGCACCCCCCAGG - Intronic
946179217 2:217939933-217939955 TCTAGCGTCCAGCAACCTCCTGG + Intronic
1170321157 20:15099507-15099529 TCTTGGATCCCTCAGCCTCCAGG + Intronic
1171956045 20:31464624-31464646 TCTAGCATCCCAGAGCCACCAGG + Intergenic
1172785629 20:37466514-37466536 TCTCGCACCCTGCACCCTCAGGG + Intergenic
1180190868 21:46161869-46161891 CCGAGCGCCCCGCACCCTCCTGG + Intronic
1183076542 22:35431021-35431043 TGCAGCCTCCCGCACCCACCCGG + Intergenic
950280836 3:11706675-11706697 TCTGGCCTCCCTCACCTTCCTGG + Intronic
952372656 3:32738177-32738199 TCTACCACCCTCCACCCTCCAGG - Intronic
953343232 3:42153326-42153348 TATAGCTTCCCTCACCCTCCTGG - Intronic
957738608 3:84233718-84233740 TGTAGCATACAGCCCCCTCCTGG + Intergenic
959840321 3:110967534-110967556 CCTGGCATCCCTCATCCTCCAGG - Intergenic
960155376 3:114292900-114292922 TCTAGCATTTCACACCATCCAGG - Intronic
961535300 3:127567031-127567053 TCTTGCATCCCAGAGCCTCCCGG + Intergenic
964414764 3:156435604-156435626 TCTAGCCACCCTGACCCTCCTGG + Intronic
964954253 3:162333220-162333242 TCTGGCATCCAGTACCATCCAGG + Intergenic
982816205 4:159888229-159888251 TCTTGTATCCCTCAGCCTCCTGG + Intergenic
985009480 4:185567957-185567979 GCCAGCAACCCGCAGCCTCCAGG + Intergenic
985193183 4:187400000-187400022 TCTAGCCTCCCACCCCCTACAGG - Intergenic
986049461 5:4075262-4075284 TATATCATCCCTCTCCCTCCTGG + Intergenic
987051875 5:14153803-14153825 TACAGCATCCCACAGCCTCCTGG + Intronic
987780585 5:22429204-22429226 TCATGCAGCCCCCACCCTCCTGG + Intronic
988638419 5:33013884-33013906 TATATCATCTCACACCCTCCAGG + Intergenic
993466737 5:88256707-88256729 TCTGCCATCTCCCACCCTCCTGG - Intronic
997077708 5:130700123-130700145 TATAGCATCCCACTCTCTCCTGG - Intergenic
997843113 5:137260203-137260225 CCTGGCATCCCGCACTCTTCAGG + Intronic
998011944 5:138702495-138702517 TCCAGCATCCCCCGCTCTCCAGG + Intronic
1001672735 5:173487589-173487611 TGTAGCCTCCCACTCCCTCCAGG - Intergenic
1003560401 6:7175295-7175317 TCTAGGGTCCCTGACCCTCCTGG + Intronic
1004392619 6:15222272-15222294 TCTCTCATCCCGAACCATCCCGG - Intergenic
1006105824 6:31715688-31715710 TCTGGCTTCCAGAACCCTCCAGG + Intronic
1007336562 6:41158966-41158988 TCTAGCAGCCAGCGCCCTCTGGG - Exonic
1008396396 6:51012732-51012754 TCTGGCATCCCCTCCCCTCCTGG + Intergenic
1016534317 6:145093283-145093305 TCTGGCTTCCCGCAGGCTCCAGG - Intergenic
1018899540 6:168044242-168044264 ACTAGCACCCCTCACCCTCCGGG - Intronic
1018899564 6:168044325-168044347 ACTAGCACCCCTCACCCTCCGGG - Intronic
1018899639 6:168044580-168044602 ACTAGCACCCCTCACCCTCCGGG - Intronic
1022131583 7:27409559-27409581 TGAAGCCTGCCGCACCCTCCAGG - Intergenic
1029404470 7:100366439-100366461 TCCACCATCCAGCCCCCTCCTGG - Intronic
1031555964 7:123176764-123176786 TCCAAGATCCCACACCCTCCTGG + Intronic
1032121399 7:129159785-129159807 GCTAGCAGCTCCCACCCTCCTGG + Intronic
1032748573 7:134812999-134813021 TCTAGCACATCTCACCCTCCTGG - Intronic
1034559263 7:151869661-151869683 TCTAGCTGCCCGTTCCCTCCAGG + Intronic
1035323565 7:158050560-158050582 GCTTGCATCCCACAGCCTCCCGG + Intronic
1037504527 8:19516803-19516825 TCCAGCATCTCACCCCCTCCTGG - Intronic
1037855408 8:22367621-22367643 TCTAGCATCCCGCACCCTCCAGG - Intronic
1040051794 8:43022336-43022358 TCTCGCATACAGCACCTTCCTGG + Exonic
1041108921 8:54467385-54467407 TCTCGCATCCGGCGCCTTCCAGG + Intergenic
1191945431 X:66529666-66529688 TATGGCATCCCTCTCCCTCCTGG + Intergenic
1192332838 X:70191846-70191868 TGTATCATCCCACTCCCTCCTGG - Intronic
1192486694 X:71533587-71533609 TCTAGCATTCCACTCTCTCCAGG + Intronic
1193576122 X:83198430-83198452 TATAGCATCCCACTCTCTCCTGG + Intergenic
1195326037 X:103759283-103759305 ACTAGCATCCGGCTCCCTCCTGG - Intergenic
1200022764 X:153225926-153225948 TCTAGCATCCAGCACAGTCCTGG + Intergenic
1202173997 Y:22080680-22080702 TCTTGTATCCTTCACCCTCCAGG - Intronic
1202217363 Y:22505702-22505724 TCTTGTATCCTTCACCCTCCAGG + Intronic
1202325823 Y:23690357-23690379 TCTTGTATCCTTCACCCTCCAGG - Intergenic
1202544948 Y:25979697-25979719 TCTTGTATCCTTCACCCTCCAGG + Intergenic