ID: 1037855410

View in Genome Browser
Species Human (GRCh38)
Location 8:22367633-22367655
Sequence GGGATGCTAGAGCCGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855407_1037855410 -8 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855410 8:22367633-22367655 GGGATGCTAGAGCCGCAGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 192
1037855398_1037855410 29 Left 1037855398 8:22367581-22367603 CCGCGCTGGCGAGGGGAGAGGTC 0: 1
1: 0
2: 1
3: 7
4: 154
Right 1037855410 8:22367633-22367655 GGGATGCTAGAGCCGCAGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 192
1037855405_1037855410 -3 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855410 8:22367633-22367655 GGGATGCTAGAGCCGCAGAAGGG 0: 1
1: 0
2: 2
3: 8
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855410 Original CRISPR GGGATGCTAGAGCCGCAGAA GGG Intronic