ID: 1037855411

View in Genome Browser
Species Human (GRCh38)
Location 8:22367645-22367667
Sequence ACGCTCTGGGCACCCTTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855411_1037855417 5 Left 1037855411 8:22367645-22367667 CCGCAGAAGGGTGCCCAGAGCGT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1037855417 8:22367673-22367695 GCCGCGCCGAAGGCTGAGCCAGG 0: 1
1: 0
2: 1
3: 29
4: 1064
1037855411_1037855422 25 Left 1037855411 8:22367645-22367667 CCGCAGAAGGGTGCCCAGAGCGT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1037855422 8:22367693-22367715 AGGCTCCCGGATTCCCCGCGCGG 0: 1
1: 0
2: 1
3: 12
4: 68
1037855411_1037855416 -5 Left 1037855411 8:22367645-22367667 CCGCAGAAGGGTGCCCAGAGCGT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855411_1037855420 12 Left 1037855411 8:22367645-22367667 CCGCAGAAGGGTGCCCAGAGCGT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1037855420 8:22367680-22367702 CGAAGGCTGAGCCAGGCTCCCGG 0: 1
1: 0
2: 3
3: 26
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855411 Original CRISPR ACGCTCTGGGCACCCTTCTG CGG (reversed) Intronic
900795329 1:4704316-4704338 ACACTCTGGGCACCGTTGTGGGG - Intronic
901506916 1:9690613-9690635 ATGCTCCGGGGACCCTGCTGCGG - Intronic
906097073 1:43231269-43231291 AGGCTCTTGGTAACCTTCTGGGG - Intronic
908984028 1:69995562-69995584 ACACTCTGGGGACCATTGTGGGG - Intronic
910424656 1:87108534-87108556 ACTCTTTAGGCAGCCTTCTGAGG + Exonic
911559058 1:99381824-99381846 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
912072119 1:105823323-105823345 ACACTCTGGGGACCGTTGTGGGG + Intergenic
912717062 1:111990132-111990154 TCGCCCTGGGCACCCTCCCGCGG - Intergenic
914755851 1:150561319-150561341 ACGCTCTGGGGCTTCTTCTGGGG + Intergenic
915003438 1:152614373-152614395 ACCCACTGAGCAGCCTTCTGTGG - Intergenic
916364272 1:164006184-164006206 ACACTCTGGGGACCGTTGTGGGG + Intergenic
917548814 1:176002515-176002537 ACGCTCTGGGGACTGTTGTGGGG - Intronic
921376307 1:214477085-214477107 ACCCACTGGGCACCCTGTTGCGG - Intronic
922173115 1:223173460-223173482 ACACTCTGGGGACCGTTGTGGGG + Intergenic
1065811382 10:29447049-29447071 TCCCTCTGGGCACCATCCTGGGG - Intergenic
1066804965 10:39238767-39238789 ACACTCTGGGGACCGTTGTGGGG - Intergenic
1067035237 10:42910705-42910727 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1071240814 10:83702622-83702644 AGGTTCTGGCCACCCTTCTGAGG + Intergenic
1072086691 10:92086625-92086647 GAGCTCTGGGCACACTGCTGAGG + Intronic
1072238451 10:93473261-93473283 ACTCACAGGGCAGCCTTCTGGGG - Intronic
1072853167 10:98918661-98918683 ACACTCTGGGGACTCTTGTGGGG + Intronic
1073684918 10:105741695-105741717 ACACTCTGGGGACTCTTGTGGGG + Intergenic
1075183603 10:120234458-120234480 ACACTCTGGGCACTGTTGTGGGG - Intergenic
1076393511 10:130121453-130121475 ATTTTCTGGGCACCCTGCTGGGG + Intergenic
1077531169 11:3095902-3095924 AGGCCCTGTGCACCCTGCTGTGG + Intronic
1077980304 11:7293191-7293213 ATCATCTGGGCAGCCTTCTGAGG + Intronic
1078288508 11:9982975-9982997 CTCCTCTGGCCACCCTTCTGAGG - Intronic
1078672444 11:13377112-13377134 ACCCACTGGGCTCCCTTCTCAGG + Intronic
1080167232 11:29253757-29253779 ACACTCTGGGGACTCTTGTGGGG + Intergenic
1081390800 11:42526540-42526562 GAGCTGTGGGCAGCCTTCTGGGG - Intergenic
1081423782 11:42902897-42902919 ACCATCTGAGCCCCCTTCTGGGG + Intergenic
1081485959 11:43529172-43529194 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
1081744854 11:45465647-45465669 AAGCTCTGGTCACCATTGTGGGG + Intergenic
1082305115 11:50562673-50562695 ACACTCTGGGGACCGTTGTGGGG + Intergenic
1083594949 11:63914796-63914818 AGGCGCTGGGCATGCTTCTGTGG - Exonic
1086117151 11:83264940-83264962 ACGCTCTGGGGACTGTTGTGGGG + Intronic
1086821982 11:91446072-91446094 ACAGTCTGGCCACTCTTCTGTGG - Intergenic
1087137956 11:94739621-94739643 ACAGTCTGGGCAGCCTCCTGGGG - Intronic
1087929138 11:103956221-103956243 ACGCTCTGGGGACTGTTGTGGGG - Intronic
1088213429 11:107481414-107481436 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
1088510073 11:110565147-110565169 AGGCTCTGGGGACCCATCTCAGG - Intergenic
1088787934 11:113199615-113199637 ACGCTCTGGGGACTGTTGTGGGG + Intronic
1088944144 11:114491991-114492013 ACGCTCTGGGGACTGTTGTGTGG + Intergenic
1089094350 11:115906441-115906463 AGGGTCTGGGCAACTTTCTGGGG + Intergenic
1089819665 11:121213205-121213227 GGGCTGTGGGCACCCTACTGTGG - Intergenic
1090151210 11:124386416-124386438 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1090641718 11:128734984-128735006 ACCCTCTGGACTCCCTTCCGTGG - Intronic
1091838775 12:3604586-3604608 ATTCACTGGGAACCCTTCTGGGG - Intergenic
1092010386 12:5105622-5105644 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1093302813 12:17476274-17476296 ACACTCTGGGGACTGTTCTGGGG + Intergenic
1093775594 12:23070791-23070813 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1095060963 12:37687588-37687610 ACACTCTGGGGACCCTTGTGGGG + Intergenic
1095196385 12:39323521-39323543 CAGCTTTGGGCAGCCTTCTGAGG + Intronic
1095591853 12:43912329-43912351 ACGCTCTGGGGACTGTTGTGGGG + Intronic
1096631067 12:52927139-52927161 AGGCTGTGGACACCCTTCTGAGG - Intronic
1096920570 12:55081525-55081547 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1098615217 12:72514796-72514818 ACACTCTGGGGACTGTTCTGGGG - Intronic
1101071576 12:101081376-101081398 CTGATGTGGGCACCCTTCTGGGG + Intronic
1101175588 12:102147547-102147569 ACACTCTGGGGACTCTTGTGGGG + Intronic
1102620334 12:114189516-114189538 AGTCTCTGGGCACCAGTCTGGGG + Intergenic
1104480691 12:129105375-129105397 ACACTCTGGGGACCGTTGTGGGG + Intronic
1105534365 13:21250545-21250567 ACACTCTGGGGACCGTTGTGGGG - Intergenic
1108709718 13:53020697-53020719 ATGCCCTGGGCTTCCTTCTGTGG + Intergenic
1111723526 13:91976103-91976125 ACGCTCTGGGGACTGTTATGGGG + Intronic
1111874872 13:93880546-93880568 ACGCTCTGGGGACTGTTGTGGGG + Intronic
1113798232 13:113071664-113071686 AAGCTCTGGGCACATTTGTGTGG + Intronic
1113933404 13:113980649-113980671 TCCCTCTCGACACCCTTCTGGGG - Intronic
1114541374 14:23462486-23462508 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1114701781 14:24686044-24686066 ACACTCTGGGGACTCTTGTGGGG + Intergenic
1114893019 14:26949610-26949632 ACACTCTGGGGACCGTTGTGGGG - Intergenic
1115831823 14:37351067-37351089 ACACTCTGGGGACCGTTGTGGGG - Intronic
1116060785 14:39921666-39921688 ACACTCTGGGGACCGTTGTGGGG - Intergenic
1117734919 14:58758906-58758928 CTGCTCTGAGCACCCTTTTGAGG + Intergenic
1118104521 14:62642531-62642553 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
1119610403 14:76056924-76056946 ATGCCCTGGGCACCCTGCAGTGG + Intronic
1120065301 14:80033529-80033551 ACGCTCTGGGGACAGTTGTGGGG + Intergenic
1121377823 14:93430507-93430529 CCTCTCTGGTCACCCTGCTGAGG + Intronic
1123000956 14:105293797-105293819 ACCCTCTGGGGACTCTCCTGAGG + Intronic
1124211613 15:27769397-27769419 ACGCTCCGGGCACTATTCTGGGG - Intronic
1127004932 15:54558084-54558106 ACGCTCTGGGGACTGTTGTGGGG + Intronic
1128562577 15:68678348-68678370 AGGCCTGGGGCACCCTTCTGGGG - Intronic
1128863707 15:71096154-71096176 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
1130125612 15:81091745-81091767 ACGCTCTGGGGACTGTTGTGGGG + Intronic
1130928953 15:88407083-88407105 ATGCTCAGGGCACCCTTTTAGGG - Intergenic
1132809550 16:1790969-1790991 ACGCCCTGGGCCCCCTGCAGCGG - Exonic
1133152723 16:3848996-3849018 ACGCTCTCATCAACCTTCTGGGG + Intronic
1135267841 16:21042830-21042852 ACACTCTGGGGACCGTTGTGGGG - Intronic
1138999180 16:62488666-62488688 ACACTCTGGGGACCGTTTTGGGG - Intergenic
1141024712 16:80535122-80535144 AAGCTCTGACCAGCCTTCTGTGG + Intergenic
1141913647 16:87077864-87077886 AGGCTCTGGGCACACTGCTGTGG + Intergenic
1141928107 16:87182448-87182470 AAGCCCTGGGCTCCCTTCAGAGG - Intronic
1142597972 17:1038802-1038824 ATTCTCTGGCAACCCTTCTGTGG + Intronic
1146668109 17:34718179-34718201 AGGCTCTCTGTACCCTTCTGGGG + Intergenic
1150210771 17:63440329-63440351 GCGGCCTGGGCAGCCTTCTGTGG - Intronic
1151220379 17:72607137-72607159 AGGCGCTGGGGACCCTTCTAGGG - Intergenic
1153751735 18:8239154-8239176 ACACTCTGGGGACTCTTGTGGGG - Intronic
1157028241 18:43872988-43873010 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
1158764290 18:60430587-60430609 ACACTCTGGGCACTGTTGTGGGG - Intergenic
1159424790 18:68271356-68271378 ACACTCTGGGGACCGTTGTGGGG + Intergenic
1160112573 18:76047682-76047704 ATGCTCTTGGCCCGCTTCTGAGG - Intergenic
1161139522 19:2639400-2639422 GTTCTCTGGGCATCCTTCTGTGG - Intronic
1161596975 19:5155473-5155495 AGGCTCTGGGGACACTGCTGAGG + Intergenic
1162061071 19:8095868-8095890 ACTTTCTGGGCATCTTTCTGTGG + Intronic
1162798747 19:13099704-13099726 ACGCGCCGGGCCACCTTCTGGGG + Exonic
1164246075 19:23430290-23430312 ACACTCTGGGCACTGTTGTGGGG - Intergenic
1164348632 19:27302269-27302291 ACACTCTGGGGACAGTTCTGGGG - Intergenic
1164357833 19:27462774-27462796 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
1164977839 19:32587672-32587694 ACACTCTGGGGACTCTTGTGGGG - Intergenic
1165285530 19:34838796-34838818 AGGCTCTGGGCTCCTCTCTGGGG - Intergenic
1167384346 19:49155390-49155412 TGGCTCTGGACACCCCTCTGAGG + Exonic
925221917 2:2148584-2148606 AAGCCCTTGGCACCTTTCTGTGG - Intronic
925634205 2:5927012-5927034 AGGCTCAGGGCAGCCTTCCGAGG - Intergenic
930913549 2:56660462-56660484 ACACTCTGGGCACTGTTGTGAGG - Intergenic
933197465 2:79408463-79408485 ACACTCTGGGGACTCTTGTGGGG - Intronic
933224298 2:79727736-79727758 ACACTCTGGGGACCGTTGTGGGG - Intronic
934481794 2:94656059-94656081 ACACTCTGGGGACCGTTGTGGGG - Intergenic
935808085 2:106768664-106768686 CCACTCTGGGCAGCCTACTGGGG + Intergenic
937336237 2:121064089-121064111 CAGCTCTGGGCACCCTCCTCTGG - Intergenic
938475989 2:131614084-131614106 ACACTCTGGGCACTGTTGTGGGG - Intergenic
940450980 2:153836666-153836688 ACACTCTGGGGACCGTTGTGGGG - Intergenic
941472239 2:165902450-165902472 ACACACAAGGCACCCTTCTGGGG + Intronic
945823249 2:214689624-214689646 ACACTCTGGGCACTGTTGTGGGG + Intergenic
946150042 2:217758477-217758499 ACACTCTGGGGACTCTTGTGGGG - Intergenic
946399722 2:219461939-219461961 AGGCTCTGGGAACTCCTCTGGGG - Exonic
947188178 2:227472820-227472842 ACGTTCTGGGCAGCCTTCGTGGG + Intronic
947465715 2:230343243-230343265 ACACTCTGGGCACCTGTCGGGGG - Intronic
948741413 2:240048957-240048979 GCTCTCTGGGCACCCTGGTGAGG - Intergenic
1169197232 20:3689817-3689839 TTGCTCGGGGCACCCTTGTGTGG - Intronic
1169875057 20:10287991-10288013 ACACTCTGGGGACTCTTGTGGGG + Intronic
1169903115 20:10572789-10572811 GCCCTCTGCTCACCCTTCTGTGG + Intronic
1173257158 20:41401961-41401983 CCGTGCTGGGCACCCTACTGAGG - Intergenic
1173793395 20:45842187-45842209 ACACTCAGTGCACCCTTGTGTGG - Intronic
1173872588 20:46351220-46351242 AGGCTCAGGGCTCTCTTCTGTGG - Intronic
1175502847 20:59462455-59462477 AGGCTCTGTGCACCGTGCTGAGG + Intergenic
1176115657 20:63430899-63430921 TGGCGCTGGGCACCCATCTGGGG - Intronic
1177351355 21:19946066-19946088 ACACTCTGGGGACTGTTCTGGGG - Intergenic
1177721134 21:24908422-24908444 ACACTCTGGGCACTGTTGTGGGG + Intergenic
1180149416 21:45940115-45940137 ACGCTCTGAGGACCCTTCCGTGG - Exonic
1180769339 22:18369292-18369314 ACACTCTGGGGACTCTTGTGGGG - Intergenic
1181533935 22:23532208-23532230 ACTCTCTGGGCCCCCTGCTGCGG - Intergenic
1183306763 22:37086891-37086913 AAGCTCTGGGCAGATTTCTGGGG - Intronic
1184931733 22:47686357-47686379 ATGTACTGGGCACCTTTCTGGGG - Intergenic
1185093105 22:48786820-48786842 CCCCTCTGGGCAGCCCTCTGTGG + Intronic
949215871 3:1566363-1566385 ACACTCTGGGCACTGTTGTGGGG + Intergenic
950093773 3:10316025-10316047 AAGCTCTGGGCACACTACTAGGG - Intronic
950374141 3:12556684-12556706 ACTCACTGGGCACCCTTCTCAGG - Intronic
950592468 3:13948227-13948249 CCCCTCTGGCCACCCTTCTGCGG + Intronic
951910410 3:27744330-27744352 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
952495284 3:33910593-33910615 CAGCTCAGGGCACCCTTCAGAGG + Intergenic
953106824 3:39889511-39889533 ACACTCTGGGGACCGTTGTGGGG + Intronic
953783917 3:45896434-45896456 ACCCTGTGGCCACCTTTCTGAGG + Intronic
953915986 3:46921561-46921583 ACACTCAGGGCTGCCTTCTGCGG - Intergenic
957101276 3:75831920-75831942 ACGCTCTGGGGACTCTTGTGGGG - Intergenic
958408040 3:93772783-93772805 ACACTCTGGGGACCGTTGTGGGG + Intergenic
959797339 3:110445935-110445957 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
960783109 3:121342506-121342528 ACACTCTGGGGACCGTTGTGGGG - Intronic
961473032 3:127129515-127129537 CTGCTCTGGGCACCCTTATCTGG - Intergenic
961473274 3:127131848-127131870 CTGCTCTGGGCACCCTTATCAGG - Intergenic
962138255 3:132760812-132760834 ACACTCTGGGGACCGTTGTGGGG - Intergenic
962822688 3:139067266-139067288 ACGCTCTGGGGACTGTTGTGGGG - Intronic
963140581 3:141943052-141943074 CGGCCCTGGCCACCCTTCTGAGG + Intergenic
963889198 3:150615024-150615046 ACACTCTGGGGACCATTGTGGGG - Intronic
965319473 3:167233880-167233902 AGTCTCTGGGCCCCCTTCTCAGG - Intergenic
966478276 3:180375416-180375438 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
966482363 3:180425067-180425089 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
967094301 3:186164021-186164043 CCGCTCTGGGGACCTTTCTGAGG + Intronic
968460690 4:723430-723452 ACCCTCTGGGCACCCCACTCTGG - Intronic
969131110 4:4991716-4991738 ACTCTCTGTGCTCCCGTCTGTGG + Intergenic
969457717 4:7309702-7309724 AGGCTCTGGGCTACCTGCTGGGG + Intronic
969673150 4:8600872-8600894 AGGCTCAGGGCAGCCTGCTGCGG + Intronic
970479668 4:16460313-16460335 TCCTTTTGGGCACCCTTCTGAGG + Intergenic
971725616 4:30307880-30307902 ACACTCTGGGAACCATTGTGGGG - Intergenic
971885461 4:32440480-32440502 ATACTCTGGGCACCTTTCTGTGG + Intergenic
972551088 4:40135107-40135129 ACACTCTGGGGACTCTTGTGGGG - Intronic
972594022 4:40514443-40514465 ACGATTTGGGTTCCCTTCTGCGG - Intronic
973043943 4:45511444-45511466 ACACTCTGGGGACCGTTGTGGGG - Intergenic
974245151 4:59304823-59304845 ACACTCTGGGGACCTTTGTGGGG + Intergenic
974563886 4:63558195-63558217 ACCCTCTGGACATCCTTCTTGGG + Intergenic
976063757 4:81159941-81159963 ACACTCTGGGGACCATTGTGGGG + Intronic
976150602 4:82087528-82087550 ACACTCTGGGGACTCTTCTGGGG - Intergenic
976357259 4:84132633-84132655 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
976414990 4:84762445-84762467 ACACTCTGGGGACTGTTCTGGGG + Intronic
977110967 4:92954774-92954796 ACACTCTGGGGACTCTTGTGGGG - Intronic
977380813 4:96271309-96271331 ACACTCTGGGTACCCAGCTGGGG + Intergenic
978615978 4:110596125-110596147 ACACTCTGGGGACCGTTGTGGGG + Intergenic
979873851 4:125862781-125862803 ACACTCTGGGGACTGTTCTGGGG - Intergenic
979948266 4:126861012-126861034 ACACTCTGGGGACTGTTCTGTGG - Intergenic
980668314 4:135969654-135969676 TGCCTCAGGGCACCCTTCTGAGG - Intergenic
981796928 4:148605927-148605949 ACAATCTGGGCACACTGCTGTGG - Intergenic
983549681 4:169003927-169003949 ACGCTCTGGGGACTGTTGTGGGG + Intronic
986386219 5:7236560-7236582 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
986887237 5:12254272-12254294 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
989725774 5:44584773-44584795 ACACTCTGGGGACTCTTGTGGGG + Intergenic
989868566 5:46553350-46553372 ACACTCTGGGGACAGTTCTGGGG - Intergenic
991286943 5:64988472-64988494 AAGTTCTGATCACCCTTCTGTGG + Intronic
993872230 5:93266887-93266909 ACACTCTGGGGACCGTTGTGGGG + Intergenic
993924633 5:93851612-93851634 ACACTCTGGGCACTGTTGTGGGG - Intronic
994444020 5:99849329-99849351 ACACTCTGGGGACTCTTGTGGGG + Intergenic
994556005 5:101304169-101304191 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
998301415 5:141024849-141024871 ACACTCTGGGAACTGTTCTGGGG + Intergenic
999557651 5:152762820-152762842 ACACTCTGGGGACTCTTGTGGGG - Intergenic
999671020 5:153959327-153959349 ACGCTATGGGCAGGCTCCTGGGG + Intergenic
999885722 5:155920703-155920725 ATGCTGTGGGCTGCCTTCTGGGG + Intronic
1002010547 5:176276606-176276628 ACGCTCTGGGGACTGTTGTGGGG - Intronic
1004050164 6:12069554-12069576 ACACTCTGGGGACTGTTCTGGGG + Intronic
1006394257 6:33776872-33776894 AGGCTCTGGGTTTCCTTCTGGGG + Intronic
1006986646 6:38179984-38180006 TCACTCTGGTCACCCCTCTGTGG + Intronic
1007801943 6:44401813-44401835 ACGCTCTGGGGACTGTTGTGGGG - Intronic
1010827573 6:80492433-80492455 ACACTCTGGGGACCGTTTTGGGG - Intergenic
1011365349 6:86575544-86575566 ACACTCTGGGCACTGTTGTGGGG + Intergenic
1012128349 6:95458192-95458214 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
1012235453 6:96808934-96808956 ACGCTCTGGGGACTGTTGTGGGG - Intronic
1012407529 6:98916650-98916672 ACGCTCTGGGGACTGTTGTGGGG + Intronic
1016567048 6:145466975-145466997 ACACTCTGGGGACTCTTGTGGGG + Intergenic
1018913958 6:168121427-168121449 CATCTGTGGGCACCCTTCTGTGG + Intergenic
1022841622 7:34169729-34169751 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1022899204 7:34785363-34785385 ACACTCTGGGCACTGTTGTGGGG + Intronic
1023147210 7:37163502-37163524 ACGCTCTGGGGACTGTTGTGGGG - Intronic
1023193776 7:37612212-37612234 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1024263220 7:47587275-47587297 AAGCTCTTGGCAGCCTCCTGTGG - Intergenic
1024894756 7:54245117-54245139 AGTCTCTGAGCACCCATCTGAGG + Intergenic
1031853355 7:126892295-126892317 ACACTCTGGGGACCGTTGTGGGG - Intronic
1033739139 7:144255890-144255912 ACACTCTGGGGACTGTTCTGGGG + Intergenic
1034330382 7:150277610-150277632 AGGAGCGGGGCACCCTTCTGAGG - Intronic
1034667661 7:152832238-152832260 AGGAGCGGGGCACCCTTCTGAGG + Intronic
1034945741 7:155260668-155260690 ACGGTCTGGGCCCCCTTCTGAGG - Intergenic
1037323302 8:17664416-17664438 ACGCTCTGGCCAGCCTGCTGTGG + Intronic
1037855411 8:22367645-22367667 ACGCTCTGGGCACCCTTCTGCGG - Intronic
1038894360 8:31764898-31764920 ACACTCTGGGGACCCTTGTGGGG - Intronic
1039768174 8:40652915-40652937 ACACTCTGGGGACCGTTGTGGGG + Intronic
1040367405 8:46732237-46732259 ACACTCTGGGCACTGTTGTGGGG - Intergenic
1044201188 8:89440034-89440056 ACACTCTGGGGACCGTTGTGGGG + Intergenic
1044464163 8:92484319-92484341 ACACTCTGGGGACTCTTGTGGGG - Intergenic
1045086705 8:98694509-98694531 ACACTCTGGGGACTGTTCTGGGG - Intronic
1046542305 8:115601720-115601742 ATGGTCTTGGAACCCTTCTGAGG - Intronic
1047919675 8:129621472-129621494 ACGCTCTGGGGACTGTTGTGGGG + Intergenic
1049606331 8:143530919-143530941 TCGCCCAGGCCACCCTTCTGGGG + Intronic
1051737706 9:20218689-20218711 AAGATATGGGCACCCTTCTTTGG - Intergenic
1052082482 9:24224807-24224829 ACACTCTGGGCACTGTTGTGGGG - Intergenic
1052147652 9:25071104-25071126 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1053003660 9:34591019-34591041 GCGCTCTAGGCAGCCTACTGGGG - Intergenic
1054980169 9:71197029-71197051 ACACTCTGGGGACTCTTGTGGGG - Intronic
1055705423 9:78995387-78995409 ACACTCTGGGGACTCTTGTGGGG - Intergenic
1056753583 9:89368484-89368506 AGACTCTGGGGACCCTTCTGGGG + Intronic
1057839564 9:98474772-98474794 GAGCTCTGGCCTCCCTTCTGTGG - Intronic
1058202296 9:102059315-102059337 ACACTCTGGGGACCGTTGTGTGG - Intergenic
1059173695 9:112149990-112150012 ACACTCTGGGCAAGCTTCTGGGG - Intronic
1059661782 9:116408653-116408675 ACTCTCTGGACAGTCTTCTGTGG - Intergenic
1059800948 9:117749049-117749071 AAGCTCTGGGCAAGCTACTGGGG + Intergenic
1060516775 9:124270887-124270909 ACGCTTGGGGCTCCCTTCTTAGG + Intronic
1060789327 9:126475302-126475324 ATGCCCTGGGCACCCTTCACAGG + Intronic
1061298486 9:129690274-129690296 GCCCTCTGGGCACACTTTTGAGG + Intronic
1062673532 9:137725587-137725609 ACGACCTGGGCTCCCTACTGCGG - Intronic
1203408618 Un_KI270538v1:71744-71766 ACACTCTGGGGACAGTTCTGGGG + Intergenic
1185742728 X:2546794-2546816 ACTCTCTTGGCTTCCTTCTGAGG + Intergenic
1186468538 X:9803524-9803546 AAGCGCCGGGCACCCTTCTCTGG - Intronic
1186913810 X:14198181-14198203 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1186935844 X:14449634-14449656 GTGCTGTGGGCACCCTCCTGTGG - Intergenic
1187231223 X:17425184-17425206 GCCCTCTTGGCAACCTTCTGAGG + Intronic
1187968071 X:24632276-24632298 ACCTTCTTGGCACCCTTCTTTGG - Intronic
1190576096 X:51840593-51840615 ACACTCTGGGGACCGTTGTGGGG - Intronic
1191209538 X:57871031-57871053 ACAGTCTGGCCACTCTTCTGTGG + Intergenic
1191569330 X:62589036-62589058 ACACTCTGGGGACTTTTCTGGGG - Intergenic
1191572282 X:62643093-62643115 ACACTCTGGGGACCGTTGTGGGG + Intergenic
1193009490 X:76660434-76660456 ACACTCTGGGGACTCTTGTGGGG - Intergenic
1193705750 X:84819122-84819144 ACACTCTGGGGACTGTTCTGGGG + Intergenic
1194385428 X:93246511-93246533 ACACTCTGGGGACTGTTCTGGGG - Intergenic
1195425916 X:104730381-104730403 ACACTCTGGGGACTGTTCTGGGG - Intronic
1197008350 X:121531362-121531384 ACACTCTGGGGACTGTTCTGGGG - Intergenic
1197036811 X:121883343-121883365 ACACTCTGGGGACCGTTGTGGGG + Intergenic
1198401825 X:136275976-136275998 ACGCACTGCTCACACTTCTGAGG - Intergenic
1198451908 X:136775047-136775069 ACATTCCGGGCACTCTTCTGGGG + Intronic
1199158467 X:144578206-144578228 AAATTCTGGGCACCATTCTGAGG - Intergenic
1199662511 X:150066280-150066302 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1199931289 X:152525702-152525724 ACGCTCTGGGGACTGTTGTGGGG - Intergenic
1200522031 Y:4221433-4221455 ACACTCTGGGAACACTTGTGGGG - Intergenic
1200872512 Y:8117841-8117863 ACACTCTGGGGACCTTTGTGGGG + Intergenic
1201621809 Y:15967421-15967443 ACACTCTGGGGACAGTTCTGGGG - Intergenic