ID: 1037855413

View in Genome Browser
Species Human (GRCh38)
Location 8:22367648-22367670
Sequence CAGAAGGGTGCCCAGAGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855405_1037855413 12 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855413 8:22367648-22367670 CAGAAGGGTGCCCAGAGCGTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
1037855408_1037855413 4 Left 1037855408 8:22367621-22367643 CCTGGAGGGTGCGGGATGCTAGA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1037855413 8:22367648-22367670 CAGAAGGGTGCCCAGAGCGTGGG 0: 1
1: 0
2: 1
3: 13
4: 154
1037855407_1037855413 7 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855413 8:22367648-22367670 CAGAAGGGTGCCCAGAGCGTGGG 0: 1
1: 0
2: 1
3: 13
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855413 Original CRISPR CAGAAGGGTGCCCAGAGCGT GGG Intronic