ID: 1037855416

View in Genome Browser
Species Human (GRCh38)
Location 8:22367663-22367685
Sequence AGCGTGGGTCGCCGCGCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855405_1037855416 27 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855411_1037855416 -5 Left 1037855411 8:22367645-22367667 CCGCAGAAGGGTGCCCAGAGCGT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855407_1037855416 22 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855408_1037855416 19 Left 1037855408 8:22367621-22367643 CCTGGAGGGTGCGGGATGCTAGA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855416 Original CRISPR AGCGTGGGTCGCCGCGCCGA AGG Intronic