ID: 1037855416

View in Genome Browser
Species Human (GRCh38)
Location 8:22367663-22367685
Sequence AGCGTGGGTCGCCGCGCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855407_1037855416 22 Left 1037855407 8:22367618-22367640 CCGCCTGGAGGGTGCGGGATGCT 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855411_1037855416 -5 Left 1037855411 8:22367645-22367667 CCGCAGAAGGGTGCCCAGAGCGT 0: 1
1: 0
2: 1
3: 18
4: 258
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855408_1037855416 19 Left 1037855408 8:22367621-22367643 CCTGGAGGGTGCGGGATGCTAGA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35
1037855405_1037855416 27 Left 1037855405 8:22367613-22367635 CCTGTCCGCCTGGAGGGTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 121
Right 1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855416 Original CRISPR AGCGTGGGTCGCCGCGCCGA AGG Intronic
904106429 1:28088752-28088774 GGCGTGGCTCGCCGGGCCGGCGG - Intergenic
904643018 1:31944715-31944737 GGCGTGGGTCCGCGCGCGGAGGG + Intronic
910277531 1:85464998-85465020 GGCGTGGGTGGCCCGGCCGAAGG + Exonic
1068910478 10:62374243-62374265 ACCGTGGGGCACCGCGCCGTGGG - Exonic
1073325949 10:102644079-102644101 GGCGAGGGCGGCCGCGCCGAGGG - Intergenic
1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG + Exonic
1089262398 11:117232141-117232163 CGCGGGGGTCGCCGGGCCGCAGG - Exonic
1091307264 11:134544270-134544292 TGCGTTGGTCGCCTGGCCGAGGG - Intergenic
1091730606 12:2877358-2877380 CGCGTGGGTGGGCGAGCCGAGGG + Intronic
1097889230 12:64760288-64760310 AGCGTGAGCCACCGCGCCCACGG - Intergenic
1106776682 13:33016343-33016365 AGCGGGGGTGGGCGCGCCGGCGG + Intergenic
1123627987 15:22240605-22240627 GGCGCGGATCGCCGCGCCGTGGG + Intergenic
1125626859 15:41116040-41116062 GGGGGGGGTCGCCCCGCCGACGG + Exonic
1127371118 15:58342639-58342661 TGCATGGGTCACAGCGCCGAAGG - Intronic
1128635380 15:69299165-69299187 AGCCTGGGTGGCCGCTCCGAGGG + Intronic
1130952656 15:88604924-88604946 GGCATGGGTCGCCGCGGCTAGGG - Intergenic
1132942316 16:2514321-2514343 GGCGGGGGTCGGCGCCCCGAGGG + Intronic
1133950355 16:10386184-10386206 AGCGTCGGTCGCCTCTCTGAGGG + Intronic
1143747291 17:9003632-9003654 AGCGAGGGGTGCAGCGCCGAGGG - Intergenic
1148271710 17:46266844-46266866 ACCGCGCGTCGCCGCGCCGCGGG + Intergenic
1150306584 17:64090667-64090689 AGCGTGGATCTCAGCTCCGATGG - Intronic
1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG + Exonic
1165268040 19:34677860-34677882 AGTGTGGGTCGCGGCGACGGCGG + Exonic
959849831 3:111072401-111072423 CGCGCGGGTCGCCGTGCGGATGG + Intronic
997177723 5:131796793-131796815 GGCGGGGGTCGCGGAGCCGATGG - Intronic
1013349195 6:109290549-109290571 AGCGACGGCCGCCGCTCCGAGGG + Intergenic
1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG + Intergenic
1027017394 7:74788067-74788089 AGCGGGGGGCGCCGCCCCGCAGG + Exonic
1027070628 7:75157865-75157887 AGCGGGGGGCGCCGCCCCGCAGG - Intergenic
1033227251 7:139571832-139571854 AGCTAGGGTGGCGGCGCCGAGGG + Exonic
1035167541 7:157000461-157000483 CGCGTGGGGCGCGGCGGCGAAGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1038612256 8:29068142-29068164 AGTGTGGGTCGGCCCGCAGATGG - Exonic
1057995727 9:99820531-99820553 GGCGGGGGGCGCTGCGCCGAGGG - Intergenic
1061790914 9:133058372-133058394 AGCGTGGGGAGCCTCGCCCATGG + Exonic
1198321452 X:135521743-135521765 CGCGAGGGTCGCCGCGCGGGGGG + Intronic