ID: 1037855866

View in Genome Browser
Species Human (GRCh38)
Location 8:22370253-22370275
Sequence GTGTGAGCAGGTAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037855866_1037855870 -4 Left 1037855866 8:22370253-22370275 CCTCCTTCCTTACCTGCTCACAC 0: 1
1: 1
2: 2
3: 42
4: 444
Right 1037855870 8:22370272-22370294 ACACCCTGCACTATTCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037855866 Original CRISPR GTGTGAGCAGGTAAGGAAGG AGG (reversed) Intronic
900345804 1:2209779-2209801 GTGTGAGCAGGGCAGGAGGGAGG - Intronic
901465234 1:9417128-9417150 GTGTGAGCATGTGAAGATGGAGG - Intergenic
902107056 1:14046707-14046729 CTGAGTGCAGGTAAGGAAGAGGG - Intergenic
902406861 1:16189108-16189130 TTGGGAGCTGGTCAGGAAGGAGG - Intergenic
902784735 1:18725536-18725558 GGGGGAGCAGGGAAGGGAGGGGG + Intronic
903195828 1:21687458-21687480 GTGTGAAGAGGAAAGGCAGGGGG + Intronic
903827856 1:26158352-26158374 GTGTGGGCAGAGAAGGAAGCGGG + Intergenic
903946566 1:26967772-26967794 GGGTGTGGAGGTGAGGAAGGGGG - Intergenic
904310087 1:29623512-29623534 GAGTGAGCTGGGAAAGAAGGAGG + Intergenic
904382848 1:30123262-30123284 GTGTGGGCAGGAGAGGAAAGGGG - Intergenic
904485432 1:30821875-30821897 GGATGAACAGGAAAGGAAGGTGG + Intergenic
904663346 1:32101515-32101537 GGGTGAGCAGGAAGTGAAGGGGG - Intronic
905149206 1:35913888-35913910 GTGTGTGCAGGTGAAGAACGTGG + Exonic
905498765 1:38419133-38419155 GTGGCAGCAGGTAAGGTTGGAGG + Intergenic
906059172 1:42937117-42937139 GTGGGAGCAGGGAAGGAAGAGGG - Intronic
906153427 1:43600800-43600822 GGGGGAGGAGGGAAGGAAGGAGG - Intronic
906405265 1:45537041-45537063 GTGTGTCAAGCTAAGGAAGGAGG - Intergenic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
907317340 1:53580752-53580774 GTGTGAGGAAGGAAGGAAAGCGG - Intronic
907440793 1:54476828-54476850 GCATGAGTAGGGAAGGAAGGGGG - Intergenic
907974517 1:59418469-59418491 GAGTGAGCAGGAAGGGAAGGAGG + Intronic
907990423 1:59577117-59577139 CTGGGAGGAGGTAAGGATGGCGG - Intronic
908797188 1:67842332-67842354 CTATGAGCAGGAAAGGAATGGGG - Intergenic
910981819 1:92965676-92965698 GAGTGAGTAGGTGAGGAATGAGG + Intergenic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
912345596 1:108960745-108960767 CTGTGAGGAGGTTAGGATGGGGG + Intronic
912852766 1:113141217-113141239 GTGTGAGGAGGTGGGGAAGAGGG - Intergenic
913199594 1:116485040-116485062 GAGTCAGCAGAGAAGGAAGGCGG + Intergenic
913256338 1:116957355-116957377 GTGTGAGCAGGCCAGGGAGTGGG + Intronic
914247595 1:145897469-145897491 GTGGGAGAAGGAAAGAAAGGAGG - Intronic
914823985 1:151127954-151127976 GTTTGGGAAGGTAAGGCAGGTGG - Intergenic
915593691 1:156884530-156884552 GTGGGAGCAGGGCAGGAAGGAGG - Intergenic
915994553 1:160550057-160550079 GTGGGACCAGGGAAGGATGGTGG - Intronic
916177584 1:162055496-162055518 GTGTGAGCAGAAAGGAAAGGTGG - Intergenic
917460848 1:175227859-175227881 GTGGGAGCAGGGAAGGACGTTGG - Intergenic
917713561 1:177711222-177711244 GAGAGAGCAGGGAAGGAAAGAGG + Intergenic
919781090 1:201221671-201221693 GTGACAGCAGTTAATGAAGGAGG + Exonic
919820964 1:201471730-201471752 GAGTGAGCAGATAAAGATGGGGG + Intergenic
919939867 1:202278764-202278786 GTGTGAGCAGGCAAGCAGGGTGG + Intronic
920342519 1:205284444-205284466 ATGGGAGCAGGTTTGGAAGGAGG + Intergenic
920499776 1:206478884-206478906 GTGTCAGTAGGCAAGGCAGGGGG - Intronic
920971738 1:210748904-210748926 GTGGGAGCAGGTAGGACAGGTGG - Intronic
921221773 1:212978660-212978682 CTGGGAGCAGTTTAGGAAGGAGG - Intronic
922860256 1:228810398-228810420 ATGGGGGCAGGTAAGGAAGAGGG + Intergenic
924202165 1:241671773-241671795 GTGGGAGGAGGTCAGGAAGAGGG + Intronic
924928081 1:248702946-248702968 GAGTAAGGAGGTAAGCAAGGAGG - Intergenic
1062950128 10:1492773-1492795 AGGGGAGCAGGTAGGGAAGGAGG + Intronic
1063003366 10:1945356-1945378 ATGAGAGCAGGTAAGAAGGGGGG + Intergenic
1064272859 10:13880726-13880748 ATGTGAGGAGGTAAGCCAGGTGG - Intronic
1064340518 10:14481429-14481451 TTGTGAGGAAGGAAGGAAGGAGG - Intergenic
1064420546 10:15186953-15186975 TGGTGAGGAGGTGAGGAAGGGGG + Intergenic
1064609013 10:17077729-17077751 GGGTGAGCAGGAGAGGAATGAGG + Intronic
1065162906 10:22941758-22941780 GGGTGAGGAGGAAAGAAAGGGGG + Intronic
1065251816 10:23823265-23823287 CTGAGAGCAGGCAAGGAAGCAGG - Intronic
1065334816 10:24645876-24645898 GAGTGAGAAGGAAAGGAAGAGGG + Intronic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068775362 10:60862877-60862899 GAGAGAGGAGGGAAGGAAGGAGG - Intergenic
1070386477 10:75929181-75929203 GTGTGACCAGGGAAGAAAAGTGG + Intronic
1070732689 10:78842226-78842248 CTCTGAGCAGGAGAGGAAGGGGG + Intergenic
1071345508 10:84688156-84688178 ATGTCAGCAGGTAAGGAGAGAGG + Intergenic
1072257288 10:93632060-93632082 GGGTCACCAGGCAAGGAAGGCGG - Intronic
1072619249 10:97068696-97068718 GGGAGAGCAGGAAGGGAAGGTGG - Intronic
1072756455 10:98024447-98024469 GGTTGAGCAGGAAAGGATGGAGG + Intronic
1072767142 10:98104345-98104367 GAGAGAGGAGGAAAGGAAGGAGG - Intergenic
1073546707 10:104355019-104355041 GTATGATAAGGAAAGGAAGGAGG - Intronic
1073641915 10:105261597-105261619 GTGTGAGGAGATAATGAAGATGG + Intronic
1073819844 10:107249303-107249325 GTGGGGGCAGGTAGGGATGGCGG - Intergenic
1075724268 10:124603616-124603638 GTGTGAGCAGGTTGGGCAAGGGG + Intronic
1075995625 10:126873993-126874015 GTGTGGAGAGGAAAGGAAGGAGG - Intergenic
1076235518 10:128861175-128861197 TTGTGTGCAGGTGAGGAAGTGGG - Intergenic
1076434241 10:130428872-130428894 ACATGAGCTGGTAAGGAAGGTGG + Intergenic
1076641938 10:131923312-131923334 GTTTGACCAGGAAAGGAGGGAGG - Intronic
1077338930 11:2017533-2017555 GTATGGGCAGGGAAGGGAGGCGG - Intergenic
1077497355 11:2892616-2892638 GGATGAGGAGGGAAGGAAGGAGG - Intronic
1077537877 11:3133180-3133202 GTGTGAGCTGCTGAGGAATGAGG + Intronic
1078731004 11:13974002-13974024 AAGTGAGCAGGTGAGGATGGTGG - Intronic
1079137690 11:17785189-17785211 GTGTGAGAAGGAAGGGAAAGAGG - Intergenic
1079576784 11:22013690-22013712 GTGTGAGAACATAGGGAAGGTGG + Intergenic
1079990359 11:27240166-27240188 GTATGAGAAGGTAAGGGAGAAGG - Intergenic
1080144454 11:28964081-28964103 GGGGGAGCAGAGAAGGAAGGAGG - Intergenic
1081666662 11:44920666-44920688 GTGTGACCAGGCTAGGCAGGAGG + Intronic
1081853686 11:46290793-46290815 GGGTGGGGAGGCAAGGAAGGTGG + Intronic
1082803164 11:57429164-57429186 GTGTGAGATGATGAGGAAGGAGG - Intergenic
1082881682 11:58044303-58044325 ATGTCACCAGGTAAGGAGGGAGG - Intronic
1083193447 11:61068829-61068851 GTGTGAGCAGGTAGAGCAGTAGG - Intergenic
1083310094 11:61779575-61779597 GGGTGAGCAGGGATGGCAGGCGG + Intronic
1083976962 11:66130279-66130301 GACTTACCAGGTAAGGAAGGGGG - Intronic
1084214518 11:67640132-67640154 GTGTGAGCAGGAAACGCAAGGGG + Intergenic
1084929203 11:72540688-72540710 GTTTTAGCAGGTCAGGAAGATGG + Intergenic
1084937446 11:72594704-72594726 ATGTGAGCAAGGCAGGAAGGAGG - Intronic
1088368773 11:109066366-109066388 TTGTGAGATGGGAAGGAAGGTGG + Intergenic
1088738723 11:112749382-112749404 GTGAGAGCTGGGAAGGGAGGTGG + Intergenic
1089559438 11:119336427-119336449 GGGTGGGCAGGCAGGGAAGGAGG - Exonic
1090884119 11:130861428-130861450 GTGGGCGGTGGTAAGGAAGGCGG - Intergenic
1091168974 11:133503925-133503947 GTGTGGGCAGGGAAGGCGGGAGG + Intronic
1202821914 11_KI270721v1_random:72715-72737 GTATGGGCAGGGAAGGGAGGCGG - Intergenic
1091490644 12:929743-929765 AGGTGAGCAGGTAGGGAAGTAGG - Intronic
1091490682 12:929965-929987 GGGTGAGGAGGTAAGGTAGGTGG - Intronic
1091917778 12:4281853-4281875 GGCTGAGCAGGGAAGGAAGGAGG - Intronic
1093941844 12:25063823-25063845 GTCTGAGCAGGTATAGAAGGGGG - Intronic
1094111794 12:26870167-26870189 GTGTGGGCAGGTGAGGAGTGAGG - Intergenic
1095586763 12:43858413-43858435 GTGAGAGCTGGTCAGGCAGGAGG - Intronic
1096519231 12:52174779-52174801 CTGTGAGCAGGAAAGAAAGCTGG - Intronic
1096817803 12:54212683-54212705 GTGTGGGCTGGGAAGGATGGGGG + Intergenic
1099955118 12:89345847-89345869 GGGACAGCAGGTGAGGAAGGAGG + Intergenic
1101181103 12:102218876-102218898 GTGTGAGAAGCAGAGGAAGGAGG - Intergenic
1101879580 12:108617127-108617149 CTGCCAGCAGGGAAGGAAGGAGG - Intergenic
1103264640 12:119618482-119618504 GTGAAAGCAGCTAGGGAAGGGGG + Intronic
1103328938 12:120140471-120140493 GTGTGAGTGGGTAGGGCAGGAGG - Intronic
1104289205 12:127453544-127453566 GTGTGAGGAGGGAAGGCAGAAGG + Intergenic
1105891723 13:24686919-24686941 GTGAGAGCAGGGAAGGCAGGAGG + Intronic
1106474106 13:30082572-30082594 GTGTGAGCTGGCAAGGGATGGGG + Intergenic
1106589890 13:31090064-31090086 GTGGGAAAAGGTAAGGCAGGCGG - Intergenic
1107399015 13:40050092-40050114 GAGGGAGCAGGAAAGGAGGGAGG - Intergenic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1110210091 13:72961649-72961671 GGGTGAAAGGGTAAGGAAGGGGG - Intronic
1110397804 13:75052131-75052153 GTGTGATGAGGTAATGAAGTAGG + Intergenic
1110459019 13:75723760-75723782 GAGTGAGAAGAAAAGGAAGGAGG + Intronic
1110474635 13:75899823-75899845 CTGTGAGAAGCTAAGGAGGGCGG + Intergenic
1110739493 13:78977644-78977666 GTGTGAGCATGGAAGCATGGAGG + Intergenic
1110806886 13:79765218-79765240 CTGTGAGCAGGTTGGCAAGGTGG - Intergenic
1111696464 13:91630793-91630815 GTGGGAGGAGGAAAGAAAGGGGG + Intronic
1112853051 13:103730640-103730662 CTGTGAACAGGTCAGGAATGTGG + Intergenic
1113894546 13:113755294-113755316 GAGTGAGTAGAGAAGGAAGGTGG + Intergenic
1114435370 14:22702229-22702251 GTGTGAGGAGGTAGGTCAGGAGG - Intergenic
1117869358 14:60183734-60183756 GTGTGAGAATGCAAGCAAGGAGG + Intergenic
1118817138 14:69321632-69321654 GTGAAAGCAAGGAAGGAAGGAGG - Intronic
1118992987 14:70812364-70812386 GTGTGTTCAGGAAAGGAGGGTGG + Intergenic
1120858633 14:89234751-89234773 GTGTGAGCTGGTAAGGAAAGTGG + Intronic
1121373398 14:93381934-93381956 GTGTGAACTAGTAAGGGAGGAGG + Intronic
1121523236 14:94600405-94600427 GTGTTTGCAGGGAAGGAACGAGG + Intronic
1121820728 14:96963980-96964002 GAGAGAGCAGGCAAGCAAGGAGG + Intergenic
1121830712 14:97049702-97049724 GTGTGAGGTGCTATGGAAGGTGG + Intergenic
1122046990 14:99030750-99030772 GGGTGGGCAGGGGAGGAAGGAGG - Intergenic
1122092876 14:99351753-99351775 GTGTGAAGAGGGAAGGGAGGTGG - Intergenic
1122093084 14:99352842-99352864 GCGTGAGCAGCGCAGGAAGGTGG + Intergenic
1122330776 14:100911019-100911041 GTGTGCGCAGGTGTGCAAGGCGG + Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1124407243 15:29403999-29404021 GTGTGAGCAGAGATGGCAGGAGG - Intronic
1125350957 15:38767163-38767185 GAGTGACCAGGTAAGAAAGAGGG - Intergenic
1125508492 15:40280943-40280965 GTGGGAGAAGGAAAGGACGGAGG - Intronic
1125510937 15:40291932-40291954 GGGAGAGCAGGTCAGGAAGGTGG + Intronic
1125729443 15:41884740-41884762 GGGTGACGAGGTAGGGAAGGAGG - Intronic
1127164425 15:56229975-56229997 GTGAGGGCAGATAAGGAAGGAGG - Intronic
1127800456 15:62472891-62472913 CTGTGTGCAGCTGAGGAAGGGGG + Intronic
1128789846 15:70425086-70425108 GAGTGAGCAGGAGAGGGAGGAGG + Intergenic
1129160569 15:73745368-73745390 GAGTGAGTAGGAAAGGAGGGAGG - Intronic
1129191734 15:73941540-73941562 GTGAGAGCAGGCAAGGTGGGAGG - Intronic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1130610289 15:85354901-85354923 GTCTGGGAAGCTAAGGAAGGAGG + Intergenic
1131311069 15:91290274-91290296 ATGTGAAGAGGTAAGGAAGGTGG + Intronic
1131394165 15:92073568-92073590 GTGTAAGCAGGAAAGGATGTGGG - Intronic
1131434499 15:92412265-92412287 ATGAGAGGAGGGAAGGAAGGGGG + Intronic
1134811623 16:17172184-17172206 GAGAGAGGAGGGAAGGAAGGAGG - Intronic
1136083642 16:27869021-27869043 GAGGGAGGAGGGAAGGAAGGAGG + Intronic
1136170711 16:28487548-28487570 GGGTGAGAAGGGAAGGGAGGGGG + Intronic
1137404089 16:48176452-48176474 GTGAGAGCAGTCCAGGAAGGGGG + Intronic
1138748132 16:59387288-59387310 GTGTGTGCATGCAAGGATGGAGG + Intergenic
1139644652 16:68319468-68319490 GTGTGAAGAGGCCAGGAAGGTGG + Intronic
1140732720 16:77871214-77871236 GTGGGAGGAGGTAGGGGAGGTGG - Intronic
1142338825 16:89507935-89507957 GTGTGAGGAGCGCAGGAAGGGGG - Intronic
1142375822 16:89706692-89706714 GTGTGGGCAGATCAGGATGGAGG - Intergenic
1142748097 17:1970591-1970613 GTGTCAGCGGGGAAGGAAGCTGG - Intronic
1143092760 17:4458839-4458861 TTTTGAGCAGGGAAGGGAGGTGG - Intronic
1143548292 17:7613441-7613463 TTCAGAGCAGATAAGGAAGGTGG + Intronic
1144303398 17:13944875-13944897 TGGTGATCAGGTAATGAAGGTGG + Intergenic
1146265647 17:31450914-31450936 GAGTGACCAGGTAGGGGAGGTGG - Intronic
1146485772 17:33241402-33241424 GTGAGAGCAGAGAAGGAAGGGGG - Intronic
1146680840 17:34806922-34806944 ATATGAGGAGGTAAGGAAGAGGG + Intergenic
1147426201 17:40346989-40347011 GTGTCTGCAGGTAAGGGGGGAGG + Intronic
1147607954 17:41784995-41785017 TTGGGAGCAGGGAAGGCAGGGGG + Intronic
1148473005 17:47907162-47907184 GAGTGAGTAGGGAAGGAGGGAGG + Intronic
1148615021 17:48995715-48995737 GGGAGGGCAGGTGAGGAAGGGGG - Intergenic
1148645946 17:49219771-49219793 GTGCGAGCAGGAAGGGCAGGTGG - Intronic
1149201877 17:54196172-54196194 GTGAAAACAGGTAAAGAAGGCGG - Intergenic
1150293148 17:63993222-63993244 GAGGGAGGAGGGAAGGAAGGAGG + Intergenic
1150990444 17:70251735-70251757 GTGTGGGCATGTGAGGGAGGGGG - Intergenic
1150999097 17:70352596-70352618 GTGTGAGGAGGAGAGTAAGGTGG - Intergenic
1151421985 17:74004792-74004814 GTGTGAGCAGGCTGGGGAGGAGG + Intergenic
1152507354 17:80758847-80758869 GGGGGAGCAGTGAAGGAAGGAGG + Intronic
1155252363 18:23964693-23964715 GTGTGAGCAGGAAACGCAAGGGG + Intergenic
1155269106 18:24122210-24122232 GGGTGCTCAGGTAACGAAGGGGG + Intronic
1156009825 18:32483789-32483811 GTGAGAGGAGGGAGGGAAGGGGG + Intergenic
1156691703 18:39715204-39715226 GTGAGAGAAGGCCAGGAAGGTGG - Intergenic
1157100206 18:44722348-44722370 GTGTGAGAAGGTAGGGCAGCAGG - Intronic
1157335350 18:46733691-46733713 ATGTGAGCAGGACAGGAAGTGGG + Intronic
1157599563 18:48885715-48885737 GTGGTGGCAGGTAAGGAAAGTGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159070809 18:63622058-63622080 GAGTGAGCTGGAAAGGAAGCAGG - Intergenic
1159332985 18:67025292-67025314 GTGGGAGCAGCCAAGGGAGGAGG + Intergenic
1159883355 18:73881014-73881036 ATGTGACCAGGTTAGGAAAGAGG + Intergenic
1159890956 18:73952797-73952819 GTGAGAGCAGAAAAGGAAGCTGG + Intergenic
1160409555 18:78666671-78666693 GGGTGTGCAGGAGAGGAAGGGGG + Intergenic
1160573171 18:79832223-79832245 GGATGAGCAGGTGAGGAAGGAGG - Intergenic
1160981220 19:1817460-1817482 TGGTGAGCAGGTGGGGAAGGGGG + Intronic
1161028849 19:2048779-2048801 GGGGGAGGAGGGAAGGAAGGGGG + Intronic
1161436725 19:4267909-4267931 GAGTGAGCAGAGAAGGCAGGCGG + Intronic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1162866634 19:13552882-13552904 GTGCCAGCAGGTAGGGAAGAGGG - Intronic
1165294001 19:34911455-34911477 AAGGGAGCAGGAAAGGAAGGAGG + Intergenic
1166563367 19:43747957-43747979 GGGTGAGCAGAGAAGGAGGGAGG - Exonic
1166920710 19:46227210-46227232 GAGTGGGCATGTTAGGAAGGGGG + Intergenic
1167074597 19:47240742-47240764 GTGCCAACAGGTAAGGAAAGCGG - Intergenic
1167112215 19:47469148-47469170 GTGTGTGCAGGCAAGGGTGGGGG + Intronic
1167158807 19:47754932-47754954 GTGGGAGGAAGGAAGGAAGGGGG - Intronic
1167327828 19:48836269-48836291 GTGTGAGAAAGGAAGGATGGGGG - Intronic
1167537736 19:50065753-50065775 GTGTGAGCAGGGGAGGGAGGGGG + Intergenic
1168183694 19:54682633-54682655 CTGTGAGCAGGGAAGAAAAGAGG + Intronic
927877811 2:26670501-26670523 GTGGGAGAAGGGAAGGAAGGAGG + Intergenic
927997138 2:27494534-27494556 GTGCGAGCAGGTAAGTAAAGGGG - Exonic
928739887 2:34338816-34338838 GAGGGGGCAGGTAAGGCAGGAGG - Intergenic
929451993 2:42044112-42044134 GAGAGAGGAGGGAAGGAAGGAGG + Intergenic
929524911 2:42693113-42693135 GTGTGGGGAGAGAAGGAAGGAGG - Intronic
929676136 2:43931891-43931913 GACTGAGAAGGAAAGGAAGGAGG - Intronic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
932648918 2:73533637-73533659 GTGTAAGGAGGTAGGGAAGTTGG + Intronic
934035863 2:88088117-88088139 GTGGGAGGAGGGAAGGAAAGAGG - Intronic
934974462 2:98790908-98790930 GTATGAGAAGGAAAGGATGGAGG - Intergenic
935139368 2:100339156-100339178 GCCTGACCAGGTAAGGAAAGAGG - Intergenic
935627897 2:105186051-105186073 CTTTGTGCAGGTCAGGAAGGAGG + Intergenic
935737433 2:106117600-106117622 GTGGGAGCAGGTCCTGAAGGAGG + Intronic
936373651 2:111923067-111923089 GGGTGAGCAGGGAAGAGAGGTGG - Intronic
936946986 2:117940055-117940077 CTCTGAGCAGCAAAGGAAGGTGG + Intronic
937707732 2:124940809-124940831 GTGTCAGCTGATAAGCAAGGAGG - Intergenic
937955678 2:127420616-127420638 GTGTGAGCAAGAAGGGATGGGGG - Intronic
938273681 2:129997307-129997329 ATGTGAGAAAGGAAGGAAGGGGG + Intergenic
938285880 2:130116483-130116505 GTGGGAGGAGGGAAGGAAGCAGG - Intronic
938429725 2:131222419-131222441 GTGGGAGGAGGGAAGGAAGCAGG + Intronic
940418000 2:153444212-153444234 GTGTAAGCAGGTAGGCAAGTAGG - Intergenic
941416900 2:165232228-165232250 ATGTGACCAGGTGAAGAAGGAGG - Intergenic
941746831 2:169095838-169095860 GTTGGAGCAGATAAGGAATGGGG - Exonic
944535354 2:200704322-200704344 GAGTTACCAGGTAAGGAGGGTGG + Intergenic
944541945 2:200762521-200762543 GTTTGCGTAAGTAAGGAAGGAGG - Intergenic
945346678 2:208726147-208726169 GGGTTAGCGAGTAAGGAAGGAGG - Intronic
946138641 2:217669133-217669155 GTGTAAGGAACTAAGGAAGGGGG - Intronic
946514584 2:220397775-220397797 TTGTGAGCAGGACAGGGAGGAGG + Intergenic
946716317 2:222557657-222557679 TTTTAAGCAGGGAAGGAAGGAGG + Intronic
947030189 2:225783446-225783468 GAGTGAGAAAGGAAGGAAGGGGG - Intergenic
947502840 2:230683804-230683826 TTGTGAGTGGGTAAGAAAGGAGG + Intergenic
948496466 2:238353152-238353174 ACCTGAGCAGGAAAGGAAGGGGG - Exonic
1168832296 20:853008-853030 GTGTGTGCAGGTAAAGAACTAGG + Intronic
1170432336 20:16287881-16287903 GTGAGGACATGTAAGGAAGGAGG + Intronic
1170464659 20:16611661-16611683 GAGTGAGCAGGAAGGGAAGATGG + Intergenic
1171344630 20:24456715-24456737 GAGGGAGCAGGAAAGGAGGGTGG + Intergenic
1172180610 20:33001191-33001213 AGGTGAGCAGGGAAGGCAGGGGG - Exonic
1173175445 20:40761682-40761704 ATGTGAGAAGGGAAGGAAGTGGG - Intergenic
1173427899 20:42958440-42958462 GGGTGAGGAGGAAAGGAGGGGGG + Intronic
1174306647 20:49618194-49618216 GAGTGCGGAGATAAGGAAGGAGG - Intergenic
1174391794 20:50222296-50222318 GAGTGAGCAAGTAAGAAAGGAGG - Intergenic
1174782104 20:53399402-53399424 GTGATAGCAGGTGAGGAGGGTGG + Intronic
1175170769 20:57079899-57079921 GACTAAGCAGGGAAGGAAGGGGG - Intergenic
1175294349 20:57898026-57898048 GTGGGAGCAGGTAAGGGAGATGG - Intergenic
1175597991 20:60250701-60250723 CAGTGAGCAGGCAAGGAAGCAGG + Intergenic
1176132068 20:63500372-63500394 GTGTGAGGAGGAAGGAAAGGTGG + Intergenic
1177824847 21:26071232-26071254 GTGGGGTCAGGAAAGGAAGGCGG - Intronic
1178180540 21:30156095-30156117 GTGTGAGCAGGTAAAGCATCTGG - Intergenic
1178666034 21:34547330-34547352 CAGTGAGCAGGTGAGGGAGGGGG - Intronic
1180352122 22:11814280-11814302 GTGTGAGGACGTAATGCAGGAGG + Intergenic
1180386086 22:12177786-12177808 GTGTGAGGACGTAATGCAGGAGG - Intergenic
1180410048 22:12598426-12598448 GTGTGAAATGGTTAGGAAGGTGG + Intergenic
1181044470 22:20207965-20207987 GTCTCAGCAGGCAAGGTAGGGGG - Intergenic
1181807289 22:25382905-25382927 ATGTGAGCAGGTATGTGAGGTGG - Intronic
1182123934 22:27802918-27802940 GTGTGTGTAGGGAAGGAGGGGGG + Intergenic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1183272940 22:36873229-36873251 GAGTTTGCAGGTAAGGATGGAGG + Intronic
1183698772 22:39438103-39438125 GAGTGAGGAGGGAGGGAAGGGGG - Intergenic
1183698814 22:39438209-39438231 GAGGGAGAAGGGAAGGAAGGAGG - Intergenic
1183779325 22:39988714-39988736 GTGGCAGCAGGGAAGGAGGGAGG + Intergenic
1184270784 22:43381710-43381732 GTGTGAGTTGGTAAGGAACCAGG + Intergenic
951483214 3:23183642-23183664 GTGAGATCAGGAAAGGAAGAAGG + Intergenic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
951949734 3:28186544-28186566 GTGAGAGAAGAAAAGGAAGGCGG - Intergenic
952449062 3:33413763-33413785 GTGGGTGCAGGTAAGGAAGATGG - Intronic
952863094 3:37831154-37831176 GTGGGGGCAGCTAAGGCAGGAGG + Intergenic
954405078 3:50341031-50341053 GTGTGAGGAGGGGACGAAGGAGG - Intergenic
954416684 3:50396758-50396780 AGGTCACCAGGTAAGGAAGGAGG - Intronic
954464883 3:50648507-50648529 GAGTGAGCGAGTAAGGGAGGAGG + Exonic
954638043 3:52082167-52082189 GGGTGAGGAGGGAAGGAAGAGGG + Intronic
955977363 3:64491221-64491243 ATGTGAGAAGGTAAGCAAGCAGG + Intergenic
956747343 3:72320325-72320347 TTGTGAGCAGCTGAGGAACGAGG + Intergenic
957440385 3:80238847-80238869 GTGAAGGCAGGAAAGGAAGGAGG - Intergenic
959819622 3:110717614-110717636 GTGTGTGCAGTTGGGGAAGGGGG + Intergenic
960845151 3:121997954-121997976 GTGGGAGCAGGTTGGGGAGGTGG + Intronic
960848026 3:122022342-122022364 GCGGCAGCAGGTAGGGAAGGTGG - Intergenic
960897788 3:122523555-122523577 GAGTGAGAAAGGAAGGAAGGAGG - Intergenic
961175835 3:124834500-124834522 GGGAGAGGAGGGAAGGAAGGAGG + Intronic
961381344 3:126498233-126498255 GTGTGAGCATGCCAGGGAGGAGG + Intronic
961548906 3:127655680-127655702 TTGAGAGCTGGTAAGGAAGTAGG + Intronic
961638846 3:128352165-128352187 GTGTCAGGAGGTGAGGATGGGGG - Intronic
961658941 3:128458181-128458203 GTGTGAGTAGGAAGGGGAGGAGG + Intergenic
962263416 3:133928882-133928904 GTGTGCAAAGGTAAGGAAGCAGG - Exonic
962480450 3:135793699-135793721 GTGAGAACAGGGAAGGAAGAAGG - Intergenic
962711667 3:138091611-138091633 GTGAGAGCAAGAAAGGAAGGTGG + Intronic
962868403 3:139466934-139466956 TGGATAGCAGGTAAGGAAGGAGG - Intronic
963120042 3:141768711-141768733 GATTGAGGAGGGAAGGAAGGTGG - Intergenic
963351518 3:144158064-144158086 GTGTGAGGAGGAAAGAAGGGAGG - Intergenic
964765689 3:160176758-160176780 GTCTTAGCAGCTATGGAAGGGGG - Intergenic
965747655 3:171942337-171942359 GTGTGTGCAGGAAACCAAGGTGG + Intergenic
967110756 3:186291736-186291758 GGGTGGGCGGGTAAGGAGGGTGG + Intronic
967506249 3:190255957-190255979 GTGGAAGCAGGAAAGGTAGGCGG + Intergenic
967662136 3:192125696-192125718 GTTGGAGAGGGTAAGGAAGGGGG + Intergenic
968591239 4:1460624-1460646 GAGGGAGGAGGGAAGGAAGGTGG - Intergenic
968742179 4:2336849-2336871 GAGTGAGAAGGTGAGGAGGGAGG + Intronic
968948508 4:3678156-3678178 ATGTGAGAAGGTGAGGAATGAGG + Intergenic
968948535 4:3678304-3678326 ATGTGAGGAGGTGAGGAATGAGG + Intergenic
969196264 4:5566273-5566295 GTGTGAGCCGCCAAGGCAGGGGG - Intronic
970330920 4:14983084-14983106 GTGTAAGCAGGTAAAAAAGAGGG - Intergenic
970541995 4:17089264-17089286 GTGTCAACAGGCAAGGCAGGAGG + Intergenic
970672399 4:18411972-18411994 ATGAGAGGAGGGAAGGAAGGAGG - Intergenic
970747824 4:19320507-19320529 GTGTGAGCAGGGAAGGGAGGGGG + Intergenic
971505007 4:27357046-27357068 GTGTGAGGGGCTAAGGATGGAGG + Intergenic
971891454 4:32529139-32529161 GAGTGAGCATATGAGGAAGGGGG - Intergenic
972388470 4:38590277-38590299 TTGAGAGGATGTAAGGAAGGAGG - Intergenic
973150205 4:46878238-46878260 GGGTGAGGAGGTAAGGAAAAGGG + Intronic
974000730 4:56508223-56508245 GTGTGTCAAGGTAAGGAAGAGGG - Intronic
974142801 4:57909105-57909127 GTGTGAGAAGGAAGCGAAGGTGG - Intergenic
974602622 4:64105066-64105088 GTGAGAGCAAGTGAGGTAGGGGG + Intergenic
974877599 4:67717302-67717324 GTGGGAGTAGTTCAGGAAGGAGG + Intergenic
975009800 4:69336071-69336093 CTGTGAGGAGGAAAGGAACGTGG + Intronic
975762169 4:77631235-77631257 GTTTGATCAGATCAGGAAGGTGG - Intergenic
976116696 4:81735656-81735678 GTGGGAGCAAGAGAGGAAGGAGG + Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
980384131 4:132063759-132063781 CAGTGAGGAGGTAAGGAGGGAGG - Intergenic
980452866 4:132998065-132998087 ATGTGAGCAGGAAAGCAAGTGGG + Intergenic
980607530 4:135111926-135111948 GCTTGAGCAGGTAAACAAGGTGG - Intergenic
980735201 4:136876355-136876377 GTCTGGGAAGGTTAGGAAGGGGG + Intergenic
980899173 4:138888030-138888052 GTGTGAGGAAGTCAGGAAGAGGG + Intergenic
981511076 4:145559502-145559524 GTGGGAGGAGGTAATAAAGGGGG + Intergenic
981750654 4:148090255-148090277 GTGTGACGAGGGAAGGGAGGAGG + Intronic
982334577 4:154219921-154219943 GTGGGAGGAGGGAGGGAAGGAGG - Intergenic
983517117 4:168669488-168669510 GGCTGAGGAGGTAAGGAGGGAGG + Intronic
984462792 4:180058419-180058441 GGGAGAGCAGGAAAGGAAGCGGG + Intergenic
985295255 4:188431094-188431116 GTTTTAGCAGGTCAGGGAGGTGG - Intergenic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
985846833 5:2356029-2356051 AGGTGAGGAGGTAAGGAAGGAGG - Intergenic
986128838 5:4908755-4908777 GTGCCAGCAGGAAGGGAAGGAGG - Intergenic
986283978 5:6346517-6346539 GTGAGAGGAGGGAAGGAAGGAGG + Intergenic
986287760 5:6372492-6372514 GGGTGAGCTGGTTAAGAAGGCGG + Exonic
986396357 5:7334614-7334636 GTGTGAGAAGCTAAGGTAAGAGG - Intergenic
986826784 5:11531130-11531152 GTGTGGTCAGGCAAGGATGGTGG + Intronic
986908198 5:12520601-12520623 GTGGGAGCAAGGAAGAAAGGAGG - Intergenic
987150485 5:15034583-15034605 ATGTGAGCAGGACAGGAGGGCGG + Intergenic
987347891 5:16994832-16994854 GTTTGAGCAGGAAAGGGAGAGGG + Intergenic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
989623837 5:43410690-43410712 GTGGGAGTAGGTCAGGAAGCTGG + Intronic
989660476 5:43792098-43792120 GTGTGAGTAGGTAAACAAAGCGG + Intergenic
990496626 5:56354306-56354328 GTGGGAACAGGAAAGGAAGGAGG + Intergenic
990587162 5:57223620-57223642 GTGTGAGGAGGTAAGGAAGGTGG - Intronic
990637445 5:57745005-57745027 GTGTGTGTATGTAAGAAAGGAGG - Intergenic
990723698 5:58729035-58729057 GTGGGAGCAGGTAGGAAAAGGGG - Intronic
992252398 5:74888446-74888468 TAGTGAGCAGGAAGGGAAGGAGG - Intergenic
993617329 5:90129709-90129731 CCTTGAGAAGGTAAGGAAGGAGG + Intergenic
993969365 5:94398001-94398023 GAGGGAGGAGGGAAGGAAGGAGG - Intronic
994343962 5:98663473-98663495 GTGTGAGCTGGTAGTGATGGTGG + Intergenic
995051128 5:107705189-107705211 GTGTTAGCAGGTAAGGGTGAGGG - Intergenic
996059017 5:119012174-119012196 CTGTGCACAGGTAAGAAAGGAGG - Intergenic
997106227 5:131021941-131021963 GAGTAAGCAGGAAATGAAGGAGG + Intergenic
997126666 5:131233992-131234014 GTAAGAGCAGGTAAGGAAAGAGG - Intergenic
997912205 5:137886940-137886962 GTGTCAGCAGTTAATGAAGCTGG + Exonic
998530960 5:142884149-142884171 GGGAGAGCAGGCAAGGAAGCTGG - Intronic
998534110 5:142913400-142913422 GGGGGAGAAGGAAAGGAAGGAGG - Intronic
998546355 5:143031227-143031249 TTGTGAGCAAGTAAGGATTGGGG + Intronic
998820747 5:146055753-146055775 GTGTGCTGAGGGAAGGAAGGGGG - Intronic
999130342 5:149278233-149278255 GTTTGGCCAGGAAAGGAAGGAGG - Intronic
999252227 5:150189797-150189819 GTGTGAGCAATTCAGGAAGATGG - Intergenic
999926674 5:156386233-156386255 GTGTGACAAGGTAAAGAGGGTGG + Intronic
1000723134 5:164733593-164733615 GAGTGAGAAGGCAAGGAGGGAGG + Intergenic
1001273240 5:170331589-170331611 GTGTGGGGAGGTGGGGAAGGAGG + Intergenic
1002065939 5:176651657-176651679 GGGTGAGAAGGTAAGGCAGCGGG + Exonic
1002193505 5:177490655-177490677 GAGGGAGGAGGGAAGGAAGGAGG + Intronic
1002273253 5:178086613-178086635 GTGGGAGCAGGTAAAGGAGGAGG - Intergenic
1003162451 6:3647801-3647823 GTTTGAGCAGGTTTGGAAAGTGG + Intergenic
1003388519 6:5691854-5691876 GTGTGAGTAGGTAAACAAAGCGG - Intronic
1003873655 6:10419540-10419562 TGGTGAGCAGGTAAAAAAGGAGG - Intronic
1005349382 6:24919143-24919165 ATGTGAGCAGAGAAGGAAAGAGG - Intronic
1005433808 6:25786747-25786769 GTGTGACCAGGAGAGAAAGGAGG - Intronic
1005859831 6:29891677-29891699 GTGGGAGGAGGTAGGGAGGGAGG + Intergenic
1006369320 6:33634225-33634247 GTGTGTGTAGATAAAGAAGGTGG - Intronic
1006639878 6:35484423-35484445 GTGTGATGAGGCAAGGAGGGTGG + Intronic
1006841645 6:37032174-37032196 GTGGGAGCAGGAAGGGCAGGTGG - Intergenic
1007705354 6:43787500-43787522 GTGTGAGCAAGGCATGAAGGTGG + Intergenic
1007925047 6:45643648-45643670 GTGGGAGAAGGCGAGGAAGGAGG - Intronic
1007937659 6:45747597-45747619 ATGTGAGCAGGTTCTGAAGGAGG - Intergenic
1009987035 6:70793506-70793528 GTTTGAGCAGAAAAGGAAAGAGG + Intronic
1010686527 6:78859937-78859959 GTGTGTGGAGGTAGGGAAGGCGG - Intergenic
1011443505 6:87412419-87412441 GAGTGAGCAGTGAAGGAAGTGGG + Intronic
1011765619 6:90616224-90616246 GTGGGGGCAGGTAAGAAATGGGG + Intergenic
1013486748 6:110604042-110604064 GTGGGAGCAAGAAAGAAAGGAGG - Intergenic
1014294689 6:119603974-119603996 TTGGGAGGAGGTAAGGAAGAGGG + Intergenic
1014621435 6:123672524-123672546 GACTGAGCAGGTCAGGAAGTGGG - Intergenic
1014627755 6:123750359-123750381 GTTTGAGAAAGAAAGGAAGGAGG - Intergenic
1015012115 6:128362230-128362252 GTGGGAGCAAGGGAGGAAGGAGG + Intronic
1015236436 6:130976563-130976585 GTGGAAGCAGGTACAGAAGGAGG + Intronic
1015610003 6:135006748-135006770 GAGTGAGGAGATAAGGAAGGAGG + Intronic
1016402353 6:143694162-143694184 GAGTGGGGAGGGAAGGAAGGAGG + Intronic
1018627719 6:165795897-165795919 GTCTGAGGAGGTATGGAGGGTGG - Intronic
1018954355 6:168398214-168398236 GTGTCAGCAGGTGAGGGAGAGGG + Intergenic
1019368853 7:650374-650396 GAGTGAGCAGGGAGGGAGGGAGG - Intronic
1019856883 7:3617947-3617969 GTGTGAGCAGAGAGGGGAGGAGG + Intronic
1020831215 7:13097757-13097779 GTGCAAGCAGGTCAGGGAGGAGG - Intergenic
1020985510 7:15129097-15129119 TTGTGGGCAGGTAAGAGAGGGGG + Intergenic
1022094172 7:27128817-27128839 GGAAGAGGAGGTAAGGAAGGTGG + Exonic
1022586508 7:31618359-31618381 GTGTTAGCAGGAAAGGACAGGGG - Intronic
1023138804 7:37080692-37080714 CTTTGAGAAGGTGAGGAAGGTGG - Intronic
1023565146 7:41516684-41516706 GTGGGAGTAGGGCAGGAAGGTGG - Intergenic
1023878737 7:44306924-44306946 GTGTGAGCAGGAAGAGAAGGGGG + Intronic
1023878762 7:44307024-44307046 GTGTGAGCAGGGAGAGGAGGCGG + Intronic
1023996574 7:45162341-45162363 GGGAGAGAAGGAAAGGAAGGTGG + Intronic
1024506549 7:50167092-50167114 GAGGAAGCAGGTAGGGAAGGAGG + Intergenic
1024630296 7:51241776-51241798 TTGTGAGCAGCTGAGGAACGAGG - Intronic
1024668697 7:51570538-51570560 GAGTAAGCAGACAAGGAAGGTGG + Intergenic
1024969924 7:55059605-55059627 GAGTGAGCAGGTGGGGAAGGAGG - Intronic
1027479337 7:78675386-78675408 GTAAGAGGAGGAAAGGAAGGAGG + Intronic
1029795343 7:102888650-102888672 AGTTGAGTAGGTAAGGAAGGAGG + Intronic
1030375737 7:108751354-108751376 GTATGAGGAGGACAGGAAGGAGG - Intergenic
1030674418 7:112369668-112369690 GAGTGAGCAGGAGAGGAAGAAGG + Intergenic
1030932982 7:115548443-115548465 TTGGGAGCAGGGAAGGGAGGAGG + Intergenic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1032360268 7:131248954-131248976 GTGGGAGAAGGTGAGGAAAGTGG - Intronic
1032885081 7:136128793-136128815 GTCTGTACAGGTAAGGAAAGAGG + Intergenic
1033310740 7:140260099-140260121 CTGCGCGCAGGTCAGGAAGGAGG + Intergenic
1034226336 7:149486769-149486791 GTGTGATCAGGGGAGGACGGGGG + Intronic
1034267817 7:149789722-149789744 GTGTGGGCAGAGAAGGTAGGGGG - Intergenic
1034284507 7:149875690-149875712 GGGTGAGGAGGAAAGGAGGGAGG - Intronic
1035433797 7:158842417-158842439 GTGTGACCTGGTTAGGAAGGTGG + Intergenic
1035581980 8:746197-746219 GTGTGAGAAGGCAAGGGAGCTGG - Intergenic
1035678646 8:1471579-1471601 GTGAGAGGAGGTTAGGAGGGAGG - Intergenic
1036011418 8:4729610-4729632 CTGTGAGCAGGTGAGAAAGGGGG + Intronic
1036992796 8:13617882-13617904 TTGTGAGCAGGGAAGGAGGGAGG + Intergenic
1037335371 8:17786428-17786450 GGGTGAGCCGCTGAGGAAGGAGG + Intronic
1037472712 8:19226024-19226046 GTGTGAGCTGGCAAGGTTGGAGG - Intergenic
1037855866 8:22370253-22370275 GTGTGAGCAGGTAAGGAAGGAGG - Intronic
1038363248 8:26904446-26904468 GTGGGAGCAGGTTTGGAGGGAGG + Intergenic
1038711728 8:29953211-29953233 GTGTCAGCAAGTGAGCAAGGAGG + Intergenic
1038840184 8:31177624-31177646 GTGTGCTCAGGTAAGGGAGCTGG + Intergenic
1039027673 8:33275521-33275543 GTGAGAGAAGGGAAGGGAGGTGG - Intergenic
1040866336 8:52052298-52052320 GGGTGGGGAGGGAAGGAAGGGGG - Intergenic
1041213054 8:55572065-55572087 CTGTGAGCAAACAAGGAAGGGGG - Intergenic
1041219394 8:55633789-55633811 GTGTGAGAGGGCAATGAAGGAGG - Intergenic
1041700960 8:60788530-60788552 CTGTTAGCAGGAAAGGAAGAGGG - Intronic
1042457029 8:69017464-69017486 GTGTAAGAGGGTATGGAAGGGGG - Intergenic
1044473525 8:92600020-92600042 GTGGCAGAAGGTTAGGAAGGAGG + Intergenic
1045244612 8:100432074-100432096 ATGTGAGCAGATAAGAAAGATGG + Intergenic
1045568858 8:103349349-103349371 GTGTGGGAAGGTCAAGAAGGAGG + Intergenic
1046211021 8:111076218-111076240 TTGGGAGGAGGTTAGGAAGGAGG + Intergenic
1048025554 8:130583531-130583553 GTGTGAGCAGTTAACCAATGTGG - Intergenic
1048314112 8:133349572-133349594 GTGAGGGAAGGGAAGGAAGGGGG + Intergenic
1048357311 8:133664119-133664141 GTGACAGCAGGGAGGGAAGGAGG + Intergenic
1048551695 8:135439086-135439108 GAGGGAGCAAGGAAGGAAGGAGG + Intergenic
1049231712 8:141488235-141488257 GAGGGAGCAGGGAGGGAAGGAGG - Intergenic
1049288267 8:141788278-141788300 AGCTGAGCAGGGAAGGAAGGAGG - Intergenic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1049763598 8:144342523-144342545 GTCTGAGCAGGTCAGGCAGTTGG - Intergenic
1052145695 9:25045622-25045644 GTGTGAGTAGGTAAACAAAGTGG - Intergenic
1052321338 9:27170682-27170704 GTGTGGGGAGGTAAGGGAGTGGG + Intronic
1052973575 9:34396394-34396416 GGGTGAACAGATGAGGAAGGAGG - Intronic
1053009917 9:34627292-34627314 GTGTGAGAAGGTAGGCAGGGTGG + Intronic
1055058550 9:72045935-72045957 GTGTGTGGGGGGAAGGAAGGTGG + Intergenic
1056139241 9:83658436-83658458 GGGAGACCAGGTCAGGAAGGTGG - Intergenic
1057013781 9:91632388-91632410 TTGAGAGCAGGTAAGGAAGATGG + Intronic
1057278032 9:93686612-93686634 GTGAGAGCAGGGAAGGACAGGGG + Intergenic
1057350487 9:94293114-94293136 AGCTCAGCAGGTAAGGAAGGAGG + Intronic
1057485058 9:95476295-95476317 GTGTTAGGGGGTAAGGCAGGTGG - Intronic
1057901859 9:98955341-98955363 GTGGGAGCAGGGAAGTAAGGAGG - Intronic
1057906574 9:98987983-98988005 GTGGGAGCAGGAGAGGAAAGAGG + Intronic
1057961094 9:99457825-99457847 GAGGGAGAAGGGAAGGAAGGAGG + Intergenic
1058425078 9:104869054-104869076 GGGAGAGCAGCTCAGGAAGGCGG + Intronic
1058502961 9:105640305-105640327 GTTTGAGAAGCTAAGGCAGGTGG + Exonic
1058794329 9:108483457-108483479 CTGTGAGGAGTTAATGAAGGTGG + Intergenic
1059525234 9:114985063-114985085 GTGTGAGCATGTGTGGAAGAGGG + Intergenic
1059709327 9:116853173-116853195 GGGTGAGTAGTTAAGAAAGGGGG + Intronic
1060580372 9:124740244-124740266 GTGTTTGCAGGAAAGGGAGGGGG - Intronic
1060990322 9:127845271-127845293 CTGTGGGAAGGTGAGGAAGGAGG - Intronic
1061294100 9:129667609-129667631 GGGTGAGGAGGGAAGGAAGGGGG + Intronic
1061778781 9:132983881-132983903 GAGTGAGCAGGGAAGGACTGGGG - Intronic
1185495512 X:551625-551647 GTATGTGCAAGGAAGGAAGGAGG - Intergenic
1185723636 X:2402065-2402087 TTGAGAGCAGGAAAGGCAGGAGG + Intronic
1186139266 X:6553779-6553801 GAGTCTGCAGGCAAGGAAGGTGG - Intergenic
1186816764 X:13245963-13245985 GTGTTAGCAGGTGAAGGAGGTGG + Intergenic
1188958569 X:36463519-36463541 CTGGGAGCAGGAAAGGGAGGAGG + Intergenic
1194844822 X:98792105-98792127 GAGGGAGGAGGTAAGGCAGGGGG + Intergenic
1195269356 X:103215229-103215251 GGGGGAGCAGGTAAGGAACCCGG + Exonic
1195593719 X:106663272-106663294 ATGTGAGGAGGTAGGGAAGAGGG - Intronic
1197769077 X:130078331-130078353 GTGTGAGCCGGTCAGGCTGGTGG - Intronic
1200243166 X:154508239-154508261 GAGGGAGCAGGGAAGGAGGGCGG + Intronic
1201428235 Y:13878014-13878036 GTGTGAGCAGGTTAGTTAGGAGG + Intergenic