ID: 1037861997

View in Genome Browser
Species Human (GRCh38)
Location 8:22412020-22412042
Sequence CTCCCTCCGCACGGCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037861992_1037861997 -6 Left 1037861992 8:22412003-22412025 CCTGGGTGGGGCTGGCCCTCCCT 0: 1
1: 0
2: 5
3: 73
4: 486
Right 1037861997 8:22412020-22412042 CTCCCTCCGCACGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 87
1037861991_1037861997 -5 Left 1037861991 8:22412002-22412024 CCCTGGGTGGGGCTGGCCCTCCC 0: 1
1: 0
2: 5
3: 57
4: 470
Right 1037861997 8:22412020-22412042 CTCCCTCCGCACGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 87
1037861989_1037861997 0 Left 1037861989 8:22411997-22412019 CCCTGCCCTGGGTGGGGCTGGCC 0: 1
1: 0
2: 6
3: 63
4: 498
Right 1037861997 8:22412020-22412042 CTCCCTCCGCACGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 87
1037861984_1037861997 8 Left 1037861984 8:22411989-22412011 CCTTCTCTCCCTGCCCTGGGTGG 0: 1
1: 1
2: 7
3: 73
4: 643
Right 1037861997 8:22412020-22412042 CTCCCTCCGCACGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 87
1037861990_1037861997 -1 Left 1037861990 8:22411998-22412020 CCTGCCCTGGGTGGGGCTGGCCC 0: 1
1: 2
2: 3
3: 84
4: 564
Right 1037861997 8:22412020-22412042 CTCCCTCCGCACGGCAGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037861997 Original CRISPR CTCCCTCCGCACGGCAGTGT GGG Intronic
900203094 1:1420021-1420043 CGCCCTCCGCCCGGCAGTGATGG - Intronic
903495303 1:23762434-23762456 CTGCCTCCGCCCTTCAGTGTTGG - Intergenic
903545028 1:24118613-24118635 ATCCCTCTGCACGGAGGTGTTGG + Intergenic
908389936 1:63675256-63675278 CTCCTTCAGCAGCGCAGTGTGGG - Intergenic
919842425 1:201619083-201619105 CTCCCTCTCCACTGCAGTGGGGG - Intergenic
923753463 1:236768804-236768826 CTCTTTCCACATGGCAGTGTTGG - Intergenic
1065264567 10:23961366-23961388 CTCCCCACGCATGGCACTGTTGG - Intronic
1066998220 10:42582940-42582962 CTTCCACAGCACGCCAGTGTTGG + Intronic
1067063181 10:43088628-43088650 CTCCCACCACACAGGAGTGTTGG - Intronic
1072531837 10:96326896-96326918 CTCCCTCCACACTGCTCTGTGGG + Intronic
1076086790 10:127639150-127639172 CTACCTCAGCAAAGCAGTGTGGG + Intergenic
1076137134 10:128052903-128052925 CTCTCTCCGCTCGGTAGTGTCGG - Intronic
1077331686 11:1986769-1986791 CTCCCACCGCATGGGAGTGCAGG + Intergenic
1082688665 11:56272773-56272795 GTGCCTCCGCACGCCAGCGTGGG - Intergenic
1083053125 11:59794568-59794590 GTTCCTCGGCAAGGCAGTGTGGG - Intronic
1083627160 11:64077733-64077755 CTCCCTCGGCAATGCAGTGAGGG - Intronic
1084639013 11:70413355-70413377 CTCCCTCCTCACAGCAGAGCCGG - Intronic
1087076074 11:94128488-94128510 CTCCCTCTGCAAGGCACCGTCGG + Intergenic
1087667004 11:101061792-101061814 CTCCCTCAGCACAGCTCTGTAGG - Intronic
1091301379 11:134510272-134510294 CTCCATCCGCAGGGCAGGGCGGG + Intergenic
1091301387 11:134510298-134510320 CTCCATCCGCAGGGCAGGGCGGG + Intergenic
1202814667 11_KI270721v1_random:41945-41967 CTCCCACCGCATGGGAGTGCAGG + Intergenic
1095960808 12:47833248-47833270 GTCCCTCCCCAGGGCTGTGTAGG + Intergenic
1103565355 12:121812532-121812554 CTCCCTCTGCCCAGCAGTCTCGG - Intronic
1105818402 13:24057761-24057783 CTCCCACCTGACTGCAGTGTTGG - Intronic
1106118633 13:26838711-26838733 GTCCCTGCGGACGGAAGTGTTGG + Intergenic
1109388508 13:61664996-61665018 CTCCCTTCGGACCTCAGTGTGGG - Intergenic
1112360258 13:98710904-98710926 CACCCTCCGCAAGGCTGTGAGGG - Intronic
1121019854 14:90573274-90573296 CTCCTTCCCCACTGCAGGGTGGG + Intronic
1121931701 14:97978129-97978151 CAGCCTGCGCACGGCATTGTGGG - Intergenic
1124168632 15:27352609-27352631 CTGCCTCCCCGGGGCAGTGTGGG - Intronic
1130549587 15:84881427-84881449 CTCCTTCCCCAGGGCAGTGCTGG - Intergenic
1135461922 16:22651865-22651887 CTCCAACCACACGGCAGTGCAGG - Intergenic
1137328049 16:47461267-47461289 CGCCCCCCGCACGACACTGTCGG - Exonic
1138537681 16:57668445-57668467 CTCCCTCGGCAGGGCAGGGTCGG - Intronic
1140847171 16:78901912-78901934 GTCCCTCCGCACCTCACTGTTGG + Intronic
1147507529 17:41034470-41034492 TACCCTCCACACGGCAGTCTGGG + Exonic
1147508164 17:41041016-41041038 TACCCTCCACACGGCAGTCTGGG + Exonic
1148382491 17:47210007-47210029 CTCCCTGTGCATGGCAGTTTGGG + Intronic
1152199610 17:78937692-78937714 CTCCTTCCGCACTGCACGGTGGG - Intergenic
1152244658 17:79178962-79178984 CTCCCTCCGCTGGCCAGTGGTGG + Intronic
1157499237 18:48178281-48178303 CTCCCTGAGCATGGCAATGTGGG - Intronic
1160803047 19:979416-979438 GTCCCTCCCCAGGGCTGTGTTGG + Intergenic
1160846995 19:1170436-1170458 CGCTGTCCGCCCGGCAGTGTGGG - Intronic
1161556643 19:4946378-4946400 GTCCCTCCGCACGGCAGAATAGG - Intronic
1167246632 19:48376942-48376964 CTCCCTCCCCTGGCCAGTGTGGG - Intergenic
925025280 2:602243-602265 CTCCCTCAGCACTGCAGGGTCGG - Intergenic
925845943 2:8033679-8033701 TTCCCTCCACACGGCCCTGTGGG + Intergenic
936349565 2:111702590-111702612 CTCCCTCCGGAAGGCAGACTTGG + Intergenic
936625518 2:114144168-114144190 CTCTCTACTCAAGGCAGTGTTGG + Intergenic
944923252 2:204437450-204437472 TTCCCTTCCCACGGTAGTGTAGG + Intergenic
947729574 2:232420522-232420544 CACCCCCTGCACGGCAGTGATGG + Intergenic
1168865463 20:1082242-1082264 CTCCCTCCACACCCCAGTGAAGG + Intergenic
1172303048 20:33863204-33863226 CCACCCCCGCACGGCAGAGTGGG - Intergenic
1172455195 20:35065939-35065961 TTCCCTCTCCACAGCAGTGTCGG - Intronic
1179018443 21:37615992-37616014 CTCCCTCCGCACGCCAGGTCTGG - Exonic
1182097277 22:27634574-27634596 CACCCTCAGCACAGCAGAGTGGG + Intergenic
1184744790 22:46450005-46450027 TTCCCACCGCAGGGCAGTGGAGG + Intronic
1184912080 22:47542826-47542848 CTTCCTCTGCACAGCAGTGGAGG + Intergenic
950186233 3:10947348-10947370 CTCCCTCAACAGGGGAGTGTGGG - Intergenic
955181416 3:56674464-56674486 CTCCCACCGCACTCCAGTCTGGG + Intronic
961100850 3:124197729-124197751 CTCCCTATGCACAGCAGTATAGG - Intronic
961178032 3:124852130-124852152 CTCCCGCTGCCCGGCAGAGTGGG + Intronic
961357467 3:126348102-126348124 CTCCCTCTGCACCCCGGTGTTGG - Intronic
961506860 3:127375788-127375810 CTCCCTCCCAACGGCTGTGCAGG - Intergenic
962632684 3:137295578-137295600 CTTCCTCAGCAGGGCAGTGTGGG + Intergenic
966411934 3:179653490-179653512 CTTCCTCCGGGCGGCAGAGTTGG + Intronic
970660702 4:18282149-18282171 ATCCCTCCCCACTGCCGTGTAGG - Intergenic
979339869 4:119509785-119509807 CTCCCTCAACACCTCAGTGTCGG - Intronic
988509693 5:31854891-31854913 CTCCCTCCGCGCCGCGGTGGAGG - Intronic
988978134 5:36535967-36535989 CTCCATCCGCTGGTCAGTGTGGG + Intergenic
998367432 5:141640200-141640222 CTCCCTCCGGCCCTCAGTGTTGG - Exonic
1001947021 5:175787738-175787760 CTCCCTCCCCATGACAGTGATGG + Intergenic
1005928266 6:30462669-30462691 CTCCTACCCCACGGCAGTGCTGG - Intergenic
1012168821 6:95992038-95992060 CTCCATCTGCATGGCATTGTGGG - Intergenic
1017042342 6:150317572-150317594 CTCCCTCTGCCAGGCAGTGATGG - Intergenic
1019167908 6:170111035-170111057 CTCCTTCTGCGCGGCAATGTTGG + Intergenic
1019624346 7:2008501-2008523 TTGGCTCCGCAAGGCAGTGTAGG + Intronic
1024117452 7:46207429-46207451 CCCCCTCCCCGCGGCAGTGCAGG - Intergenic
1024665731 7:51545199-51545221 CTCCCTCTGCTCTGCAGTGGGGG - Intergenic
1033300051 7:140177196-140177218 CTCCCTCCGCCCGGCCGTCGCGG - Intergenic
1033647534 7:143316714-143316736 CTCCCAGCACACTGCAGTGTGGG - Intronic
1037662967 8:20942978-20943000 CTCCCTCCACACTGCACTTTGGG - Intergenic
1037861997 8:22412020-22412042 CTCCCTCCGCACGGCAGTGTGGG + Intronic
1038455041 8:27667458-27667480 CTCCCTCCTCCAGGCAGTGCTGG + Intronic
1044841126 8:96338066-96338088 CTGCCACCGCAGGGCACTGTCGG - Intergenic
1045430327 8:102107943-102107965 TTCCCTCTGCAGGTCAGTGTGGG - Intronic
1048336139 8:133503939-133503961 CTCCCTCAGCCAGGCAGTGTGGG + Intronic
1048977128 8:139679340-139679362 CTCCCTGAGCACGGGGGTGTGGG + Intronic
1049286016 8:141775616-141775638 CTCCTTCCCCAGGGAAGTGTGGG - Intergenic
1049650546 8:143766027-143766049 TTCCCTCCCCACAGCAGTGTAGG + Intergenic
1052052740 9:23866591-23866613 CCCCCTCTGCATGGCAGTGAAGG + Intergenic
1057231030 9:93321390-93321412 CTGCTTCCCCACGGGAGTGTCGG + Intronic
1061550826 9:131333850-131333872 CTGCCTCTGCAGGGCTGTGTGGG + Intergenic
1062608199 9:137358209-137358231 GTTCCTCTGCAGGGCAGTGTTGG - Intronic
1194283661 X:91983550-91983572 CTGCCTCCGCACGGCAGCCCCGG - Intronic