ID: 1037862205

View in Genome Browser
Species Human (GRCh38)
Location 8:22413495-22413517
Sequence GGGGAGTCGAATCATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037862205_1037862215 14 Left 1037862205 8:22413495-22413517 CCCCCAAGATGATTCGACTCCCC No data
Right 1037862215 8:22413532-22413554 GAAAGTGTTGTTTCCCTGGAGGG No data
1037862205_1037862216 17 Left 1037862205 8:22413495-22413517 CCCCCAAGATGATTCGACTCCCC No data
Right 1037862216 8:22413535-22413557 AGTGTTGTTTCCCTGGAGGGTGG No data
1037862205_1037862213 10 Left 1037862205 8:22413495-22413517 CCCCCAAGATGATTCGACTCCCC No data
Right 1037862213 8:22413528-22413550 ACATGAAAGTGTTGTTTCCCTGG No data
1037862205_1037862214 13 Left 1037862205 8:22413495-22413517 CCCCCAAGATGATTCGACTCCCC No data
Right 1037862214 8:22413531-22413553 TGAAAGTGTTGTTTCCCTGGAGG No data
1037862205_1037862219 30 Left 1037862205 8:22413495-22413517 CCCCCAAGATGATTCGACTCCCC No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037862205 Original CRISPR GGGGAGTCGAATCATCTTGG GGG (reversed) Intronic