ID: 1037862208

View in Genome Browser
Species Human (GRCh38)
Location 8:22413498-22413520
Sequence CCAGGGGAGTCGAATCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037862208_1037862213 7 Left 1037862208 8:22413498-22413520 CCAAGATGATTCGACTCCCCTGG No data
Right 1037862213 8:22413528-22413550 ACATGAAAGTGTTGTTTCCCTGG No data
1037862208_1037862214 10 Left 1037862208 8:22413498-22413520 CCAAGATGATTCGACTCCCCTGG No data
Right 1037862214 8:22413531-22413553 TGAAAGTGTTGTTTCCCTGGAGG No data
1037862208_1037862219 27 Left 1037862208 8:22413498-22413520 CCAAGATGATTCGACTCCCCTGG No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data
1037862208_1037862215 11 Left 1037862208 8:22413498-22413520 CCAAGATGATTCGACTCCCCTGG No data
Right 1037862215 8:22413532-22413554 GAAAGTGTTGTTTCCCTGGAGGG No data
1037862208_1037862216 14 Left 1037862208 8:22413498-22413520 CCAAGATGATTCGACTCCCCTGG No data
Right 1037862216 8:22413535-22413557 AGTGTTGTTTCCCTGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037862208 Original CRISPR CCAGGGGAGTCGAATCATCT TGG (reversed) Intronic