ID: 1037862211

View in Genome Browser
Species Human (GRCh38)
Location 8:22413515-22413537
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037862211_1037862219 10 Left 1037862211 8:22413515-22413537 CCCTGGAAAGTCAACATGAAAGT No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG 0: 1
1: 0
2: 0
3: 19
4: 154
1037862211_1037862213 -10 Left 1037862211 8:22413515-22413537 CCCTGGAAAGTCAACATGAAAGT No data
Right 1037862213 8:22413528-22413550 ACATGAAAGTGTTGTTTCCCTGG No data
1037862211_1037862214 -7 Left 1037862211 8:22413515-22413537 CCCTGGAAAGTCAACATGAAAGT No data
Right 1037862214 8:22413531-22413553 TGAAAGTGTTGTTTCCCTGGAGG No data
1037862211_1037862215 -6 Left 1037862211 8:22413515-22413537 CCCTGGAAAGTCAACATGAAAGT No data
Right 1037862215 8:22413532-22413554 GAAAGTGTTGTTTCCCTGGAGGG No data
1037862211_1037862216 -3 Left 1037862211 8:22413515-22413537 CCCTGGAAAGTCAACATGAAAGT No data
Right 1037862216 8:22413535-22413557 AGTGTTGTTTCCCTGGAGGGTGG No data
1037862211_1037862220 29 Left 1037862211 8:22413515-22413537 CCCTGGAAAGTCAACATGAAAGT No data
Right 1037862220 8:22413567-22413589 TTGGCCTGTTTAAAACATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037862211 Original CRISPR ACTTTCATGTTGACTTTCCA GGG (reversed) Intronic