ID: 1037862212

View in Genome Browser
Species Human (GRCh38)
Location 8:22413516-22413538
Sequence CACTTTCATGTTGACTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037862212_1037862215 -7 Left 1037862212 8:22413516-22413538 CCTGGAAAGTCAACATGAAAGTG No data
Right 1037862215 8:22413532-22413554 GAAAGTGTTGTTTCCCTGGAGGG No data
1037862212_1037862220 28 Left 1037862212 8:22413516-22413538 CCTGGAAAGTCAACATGAAAGTG No data
Right 1037862220 8:22413567-22413589 TTGGCCTGTTTAAAACATAAAGG No data
1037862212_1037862214 -8 Left 1037862212 8:22413516-22413538 CCTGGAAAGTCAACATGAAAGTG No data
Right 1037862214 8:22413531-22413553 TGAAAGTGTTGTTTCCCTGGAGG No data
1037862212_1037862216 -4 Left 1037862212 8:22413516-22413538 CCTGGAAAGTCAACATGAAAGTG No data
Right 1037862216 8:22413535-22413557 AGTGTTGTTTCCCTGGAGGGTGG No data
1037862212_1037862219 9 Left 1037862212 8:22413516-22413538 CCTGGAAAGTCAACATGAAAGTG No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG 0: 1
1: 0
2: 0
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037862212 Original CRISPR CACTTTCATGTTGACTTTCC AGG (reversed) Intronic