ID: 1037862219

View in Genome Browser
Species Human (GRCh38)
Location 8:22413548-22413570
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037862208_1037862219 27 Left 1037862208 8:22413498-22413520 CCAAGATGATTCGACTCCCCTGG No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data
1037862207_1037862219 28 Left 1037862207 8:22413497-22413519 CCCAAGATGATTCGACTCCCCTG No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data
1037862211_1037862219 10 Left 1037862211 8:22413515-22413537 CCCTGGAAAGTCAACATGAAAGT No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data
1037862210_1037862219 11 Left 1037862210 8:22413514-22413536 CCCCTGGAAAGTCAACATGAAAG No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data
1037862206_1037862219 29 Left 1037862206 8:22413496-22413518 CCCCAAGATGATTCGACTCCCCT No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data
1037862205_1037862219 30 Left 1037862205 8:22413495-22413517 CCCCCAAGATGATTCGACTCCCC No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data
1037862212_1037862219 9 Left 1037862212 8:22413516-22413538 CCTGGAAAGTCAACATGAAAGTG No data
Right 1037862219 8:22413548-22413570 TGGAGGGTGGTGATTCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type