ID: 1037862220

View in Genome Browser
Species Human (GRCh38)
Location 8:22413567-22413589
Sequence TTGGCCTGTTTAAAACATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037862210_1037862220 30 Left 1037862210 8:22413514-22413536 CCCCTGGAAAGTCAACATGAAAG No data
Right 1037862220 8:22413567-22413589 TTGGCCTGTTTAAAACATAAAGG No data
1037862211_1037862220 29 Left 1037862211 8:22413515-22413537 CCCTGGAAAGTCAACATGAAAGT No data
Right 1037862220 8:22413567-22413589 TTGGCCTGTTTAAAACATAAAGG No data
1037862217_1037862220 -1 Left 1037862217 8:22413545-22413567 CCCTGGAGGGTGGTGATTCAATT No data
Right 1037862220 8:22413567-22413589 TTGGCCTGTTTAAAACATAAAGG No data
1037862218_1037862220 -2 Left 1037862218 8:22413546-22413568 CCTGGAGGGTGGTGATTCAATTT No data
Right 1037862220 8:22413567-22413589 TTGGCCTGTTTAAAACATAAAGG No data
1037862212_1037862220 28 Left 1037862212 8:22413516-22413538 CCTGGAAAGTCAACATGAAAGTG No data
Right 1037862220 8:22413567-22413589 TTGGCCTGTTTAAAACATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037862220 Original CRISPR TTGGCCTGTTTAAAACATAA AGG Intronic