ID: 1037863252

View in Genome Browser
Species Human (GRCh38)
Location 8:22421793-22421815
Sequence GTGGATTTCTAGTTTAGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037863249_1037863252 12 Left 1037863249 8:22421758-22421780 CCTTTGTCTTGGAGTAGAATACT 0: 1
1: 0
2: 2
3: 9
4: 171
Right 1037863252 8:22421793-22421815 GTGGATTTCTAGTTTAGGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 110
1037863248_1037863252 13 Left 1037863248 8:22421757-22421779 CCCTTTGTCTTGGAGTAGAATAC 0: 1
1: 0
2: 2
3: 9
4: 154
Right 1037863252 8:22421793-22421815 GTGGATTTCTAGTTTAGGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 110
1037863246_1037863252 27 Left 1037863246 8:22421743-22421765 CCTTAAACATAATACCCTTTGTC 0: 1
1: 0
2: 1
3: 18
4: 146
Right 1037863252 8:22421793-22421815 GTGGATTTCTAGTTTAGGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037863252 Original CRISPR GTGGATTTCTAGTTTAGGAG AGG Exonic
905118768 1:35665543-35665565 TTGTATTTCTAGTAGAGGAGGGG + Intergenic
906300458 1:44677918-44677940 CAGGATTTCAGGTTTAGGAGGGG - Intronic
908786532 1:67739827-67739849 GTGGAGTTCTAGTTTCACAGTGG - Intronic
909443991 1:75727663-75727685 GTGTATTAGTAGTTTAGAAGAGG + Intronic
911684641 1:100760872-100760894 TTGCATTTCTAGTTTAGCAGAGG - Intergenic
916675072 1:167058655-167058677 GTGGAATTCTAGGATAGAAGGGG - Intronic
917616690 1:176753104-176753126 GTGGCTGTCTCATTTAGGAGAGG + Intronic
918480883 1:184975185-184975207 ATTGATTTCCAGTTAAGGAGAGG - Intergenic
919501521 1:198343135-198343157 GTGTATTTCTAGTAAAGAAGGGG + Intergenic
921593267 1:217027739-217027761 TTGGGTTCCTAGTTTAGGATGGG + Intronic
923626707 1:235619916-235619938 GCAGGTTTCTTGTTTAGGAGAGG + Intronic
923704863 1:236335993-236336015 ATGGATTTGTATTTTAGGGGTGG - Intergenic
923797578 1:237172887-237172909 GTGGATTTCTATCCTAGGAGAGG + Intronic
924927938 1:248701772-248701794 GTGGATAGCTATTTTTGGAGGGG - Intergenic
1063011700 10:2027756-2027778 GTGGGATTCTGGTTTAGGACTGG - Intergenic
1063782600 10:9343539-9343561 GTGGTGTTCTAGGTAAGGAGAGG + Intergenic
1064227078 10:13496236-13496258 GTGGATTTGTAATTTGGGATTGG - Intronic
1065144402 10:22753835-22753857 TTTAATTTCTAGTTTAGAAGGGG + Intergenic
1066191388 10:33059133-33059155 CTCGATTTCTTTTTTAGGAGGGG + Intergenic
1067540999 10:47153032-47153054 GTGGGTTAATAGTTTAGGTGAGG - Intergenic
1068442961 10:57083192-57083214 GGCTATTTCTAGATTAGGAGGGG + Intergenic
1069701172 10:70427418-70427440 ATGGTTTTCCAGTTTAGTAGTGG + Exonic
1070989495 10:80718994-80719016 GTGGTTTGCTAGGTCAGGAGAGG - Intergenic
1071024962 10:81101459-81101481 GAGGATTTTTGGTTTAGTAGGGG - Intergenic
1072020138 10:91390928-91390950 CAGGATTTCCAGTCTAGGAGGGG - Intergenic
1074700916 10:116091605-116091627 GTTTATTTCTAGTTTGGGGGAGG - Intronic
1075762942 10:124870454-124870476 GTGTATTTCTAGTAAAGAAGGGG - Intergenic
1078760786 11:14249646-14249668 GTGGATCTGTAATTTAGGAGGGG + Intronic
1081276406 11:41154960-41154982 GTGGATTTGCAGCTTAGGAAAGG + Intronic
1081643823 11:44776531-44776553 GTTGATTTCTTCTTCAGGAGAGG - Intronic
1081988883 11:47327026-47327048 GTGGGTTTCGAGTTTAGAGGTGG + Intronic
1082223066 11:49665693-49665715 GTGGTTTTATAGTTTAGAAGAGG + Intergenic
1086465205 11:87045987-87046009 TTGAGTTTATAGTTTAGGAGGGG + Intronic
1086625985 11:88953539-88953561 GTGGTTTTATAGTTTAGAAGAGG - Intronic
1087295824 11:96372178-96372200 GTGGATTACTTGCTTAGCAGAGG - Intronic
1088820296 11:113450901-113450923 GAGGATTACTAGATTAGGTGAGG + Intronic
1090476926 11:127031504-127031526 TAGGGTTTCTAGTCTAGGAGAGG - Intergenic
1092764391 12:11839508-11839530 GAGAATTTTAAGTTTAGGAGAGG + Intronic
1094203649 12:27817887-27817909 GTGGTTTTGAACTTTAGGAGAGG - Intergenic
1096363957 12:51012387-51012409 GTTGATTTCAAATTTAGAAGGGG + Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1103051934 12:117787674-117787696 GTGCAAATATAGTTTAGGAGTGG + Intronic
1103281961 12:119765760-119765782 GTGGATTTCTTGGCTAGGTGTGG - Intronic
1104359742 12:128121425-128121447 TTGGATTTTAATTTTAGGAGAGG - Intergenic
1106421696 13:29590718-29590740 GTGGGTTTCTAAATTAGAAGGGG - Intronic
1107006847 13:35621419-35621441 GAGGATTGCTAGTTTAGGGGAGG - Intronic
1108856903 13:54803863-54803885 GTGAATTTGTAGCTCAGGAGTGG + Intergenic
1110159915 13:72363551-72363573 CTGGATTTCTAGGTTAGTGGGGG + Intergenic
1112039034 13:95527382-95527404 GTGGACTTCTGGTTAAGGATGGG - Intronic
1112119633 13:96395806-96395828 GTGGATTTTTAGTAAAGGAGTGG + Intronic
1115945939 14:38660694-38660716 GTGTATTCATAGTTTAGGAGGGG - Intergenic
1118388222 14:65274481-65274503 GTGGATTTCCAGATCAGCAGAGG - Intergenic
1118630404 14:67697278-67697300 GAGGAGTTCTAGATCAGGAGAGG + Intergenic
1121466348 14:94117876-94117898 TTGGATTTCTAGTTAATGCGGGG - Intergenic
1124128300 15:26959972-26959994 GTTTATTTCTAGTTTTTGAGTGG - Intergenic
1129880242 15:79001612-79001634 ATAGATTTCCAGTTTGGGAGAGG - Intronic
1130066209 15:80607049-80607071 TTGTATTTCTAGTAAAGGAGGGG - Intergenic
1130914753 15:88296340-88296362 GTGGTTTTCCAGTTTAAAAGCGG + Intergenic
1144148421 17:12420416-12420438 GGGGATTTCAAGTGGAGGAGTGG + Intergenic
1149681863 17:58513004-58513026 GTGGATTTCTTGGTGGGGAGAGG - Intronic
1149911358 17:60569831-60569853 GTTGATGTCTAGTTTCAGAGAGG - Intronic
1151112901 17:71700583-71700605 GTGGTAATCTAGTTTTGGAGAGG + Intergenic
1153798007 18:8642432-8642454 GTGGATTTCTTGTAAAGCAGTGG + Intergenic
1158924551 18:62240883-62240905 GTGGAGTTCTAAATAAGGAGGGG + Intronic
1164523493 19:28996567-28996589 GTGTATTTTTAGTATAGGCGGGG - Intergenic
933276354 2:80288576-80288598 GTGGATTCCTGGTTTATGTGTGG - Intronic
934088604 2:88531055-88531077 GGGGTTTATTAGTTTAGGAGAGG + Intergenic
936761690 2:115793087-115793109 GTTGATTTTTAGTTTATAAGAGG + Intronic
937735624 2:125284571-125284593 GTGGATTTCAAGTTGAAGTGTGG - Intergenic
940611284 2:155994883-155994905 TTGGATTTAGAGTTGAGGAGGGG + Intergenic
941860126 2:170270710-170270732 TTGGAATGGTAGTTTAGGAGAGG + Intronic
944312748 2:198252602-198252624 TTGGATGTCTAGTTGAGGACAGG + Intronic
946952807 2:224895635-224895657 GGGGATTTTTACTTTAGAAGGGG + Intronic
947312686 2:228821433-228821455 CTGGTCTTCTAGGTTAGGAGGGG - Intergenic
1169468688 20:5864136-5864158 ATGGATTTCTAGCTTTGGAGAGG - Intergenic
1169916801 20:10691368-10691390 GTGGATTACTTGTTGAGGACAGG - Intergenic
1174767369 20:53266736-53266758 GTGGAGTTCTAGTCTAGCAGGGG + Intronic
950683285 3:14600151-14600173 GTGGATTTCTGGGTCATGAGTGG - Intergenic
951876870 3:27436816-27436838 GTGTATTGCAAGTTTAGAAGAGG - Intronic
952261263 3:31742780-31742802 GTGGGTTTCAAGTGTGGGAGGGG - Intronic
957776104 3:84758950-84758972 GTGGATTTCTGGAGTATGAGAGG + Intergenic
958903897 3:99921042-99921064 GAGGGTTGCTAGTTTGGGAGTGG + Intronic
960189100 3:114681606-114681628 GTGGATTTGTATTTTAATAGAGG + Intronic
962290228 3:134129631-134129653 GTGGATGCCTAGTTGAGAAGAGG - Intronic
965841753 3:172913310-172913332 GTGGAAATATAGTTGAGGAGTGG + Intronic
970127099 4:12827026-12827048 CTGGATTTCTACTTTATTAGTGG + Intergenic
970177780 4:13356639-13356661 GTGGATTTGTAGTTTAGCCCAGG + Intergenic
972259745 4:37396261-37396283 GTGGATTGCTGGGGTAGGAGTGG - Intronic
978784242 4:112591779-112591801 GTGGAGTTCTATTTTAGGCAAGG - Intronic
981172706 4:141643435-141643457 GTGTATTTCTAGTGGAGCAGTGG - Intronic
981191987 4:141874548-141874570 GGGGATTTATACTTCAGGAGAGG + Intergenic
981893138 4:149763471-149763493 CTGATGTTCTAGTTTAGGAGAGG - Intergenic
990704034 5:58507387-58507409 GTGGATTTCCAGGTTCAGAGAGG - Intergenic
991550220 5:67827301-67827323 GTGGATGGCTAGTTTAGTGGTGG - Intergenic
992217389 5:74539314-74539336 GTCCATTTCTAGCTGAGGAGGGG + Intergenic
992473316 5:77078098-77078120 GAGGATTCCTAGTATAGGAAGGG - Intronic
994279726 5:97886612-97886634 CTGGCCTTCCAGTTTAGGAGCGG - Intergenic
996063276 5:119054800-119054822 ATGGATTTATAGTTTAGAATTGG - Intronic
996132590 5:119799596-119799618 CTGGAGTTTTAGTTTAGTAGAGG + Intergenic
998947578 5:147356577-147356599 GTGGGTTTCTATTTTAGCAGAGG - Intronic
1006698060 6:35948649-35948671 GTGTATTTCTAGTTTAGTTGTGG - Intronic
1009659626 6:66594058-66594080 GTGGTTTTCTATTTTAGGGGGGG + Intergenic
1010418791 6:75647327-75647349 GTGTATTTGAAGTTTAAGAGAGG + Intronic
1013449600 6:110266605-110266627 GTAGATTTCTAGAGTAAGAGAGG - Intronic
1022197828 7:28086092-28086114 GTTGAATTATAATTTAGGAGTGG - Intronic
1028089014 7:86673922-86673944 GTGAAGTTCTAGTTTAGGGCAGG - Intronic
1031704775 7:124966021-124966043 GTGGTTTTCTGGGTTGGGAGAGG + Intergenic
1032002464 7:128274365-128274387 GTGGAGTTTTTGTTTAGGAGAGG - Intergenic
1034390610 7:150784693-150784715 GTGAATTCCTACTTCAGGAGGGG + Intergenic
1037863252 8:22421793-22421815 GTGGATTTCTAGTTTAGGAGAGG + Exonic
1037902313 8:22695122-22695144 GTGGCTCCCTAGTATAGGAGTGG - Intergenic
1038056725 8:23865571-23865593 GTGGATTGCGAGCTCAGGAGGGG + Intergenic
1040330431 8:46383061-46383083 GAGGACTTCTAGTATAGAAGTGG - Intergenic
1048139343 8:131777912-131777934 GTGGGTTTCTACTGTGGGAGAGG - Intergenic
1056092502 9:83218493-83218515 GTGGGCTTTTAGTTTTGGAGTGG - Intergenic
1056373869 9:85987612-85987634 GAGGATTTCTAGTTTGGGGATGG + Intronic
1057235552 9:93355861-93355883 GTACATTTCTAGTCTAGGTGTGG + Intergenic
1060062414 9:120472652-120472674 GTGGATTTTTATTCTGGGAGAGG + Intronic
1186944269 X:14547775-14547797 TGGGATTTGTAGTTTAAGAGAGG - Intronic
1187070486 X:15882702-15882724 GTGGAGTCCTAATTAAGGAGAGG + Intergenic
1189954075 X:46260655-46260677 GTGAATTCCTTGTTCAGGAGGGG - Intergenic
1191731350 X:64339067-64339089 GTGGGTTTGAAGTTCAGGAGAGG + Intronic
1193308479 X:79976950-79976972 GTGGACTCCTAGTTTGGGGGAGG + Intergenic
1194729392 X:97436111-97436133 GTGTATTTGTATTTTAAGAGTGG - Intronic
1196150767 X:112370837-112370859 ATTGATTTCTAATTGAGGAGTGG + Intergenic