ID: 1037865697

View in Genome Browser
Species Human (GRCh38)
Location 8:22440914-22440936
Sequence CTCTCGGCTCCTCCGGCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 1, 2: 6, 3: 32, 4: 389}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037865697_1037865709 25 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865709 8:22440962-22440984 CTCGCGGGAAGGCGGAAGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 181
1037865697_1037865705 17 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865705 8:22440954-22440976 TCTACTGCCTCGCGGGAAGGCGG 0: 1
1: 0
2: 0
3: 1
4: 59
1037865697_1037865701 9 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865701 8:22440946-22440968 CGCCGAGCTCTACTGCCTCGCGG 0: 1
1: 0
2: 0
3: 7
4: 44
1037865697_1037865702 10 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865702 8:22440947-22440969 GCCGAGCTCTACTGCCTCGCGGG 0: 1
1: 0
2: 0
3: 6
4: 58
1037865697_1037865710 26 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865710 8:22440963-22440985 TCGCGGGAAGGCGGAAGGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 124
1037865697_1037865712 30 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865712 8:22440967-22440989 GGGAAGGCGGAAGGGTGGGGAGG 0: 1
1: 0
2: 14
3: 280
4: 3390
1037865697_1037865707 22 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865707 8:22440959-22440981 TGCCTCGCGGGAAGGCGGAAGGG 0: 1
1: 0
2: 0
3: 6
4: 61
1037865697_1037865711 27 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865711 8:22440964-22440986 CGCGGGAAGGCGGAAGGGTGGGG 0: 1
1: 0
2: 2
3: 17
4: 257
1037865697_1037865704 14 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865704 8:22440951-22440973 AGCTCTACTGCCTCGCGGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 59
1037865697_1037865706 21 Left 1037865697 8:22440914-22440936 CCCGGAGCCGGAGGAGCCGAGAG 0: 1
1: 1
2: 6
3: 32
4: 389
Right 1037865706 8:22440958-22440980 CTGCCTCGCGGGAAGGCGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037865697 Original CRISPR CTCTCGGCTCCTCCGGCTCC GGG (reversed) Intronic
900418777 1:2546718-2546740 CTCTCGGCGGCCCGGGCTCCGGG - Intergenic
900595159 1:3477114-3477136 CCCCCGGCACCTCCCGCTCCCGG - Intronic
901180591 1:7338971-7338993 CTCTCTCATCCTCCTGCTCCAGG - Intronic
901435112 1:9242787-9242809 CTGGCGGCTCCTCCTTCTCCAGG + Intronic
901445594 1:9306094-9306116 GTCTCGGTTCCTCCCGCTGCAGG - Intronic
901759181 1:11459596-11459618 CTCTGGCCTCTTCCAGCTCCTGG + Intergenic
902518671 1:17003481-17003503 CTCACTGCACCTCCGCCTCCTGG - Intronic
903034026 1:20483482-20483504 CTCTCGCCTCATCTGTCTCCCGG + Exonic
904044852 1:27603101-27603123 CCCGCGGCTCCCCCGGCTCGGGG - Intronic
905375549 1:37518112-37518134 CTCTCGGCACCTCCCCCGCCTGG + Intergenic
905974201 1:42163538-42163560 CCCTGGGCTCCTGGGGCTCCTGG + Exonic
906224464 1:44109979-44110001 CTCACTGCACCTCCGCCTCCCGG + Intergenic
906291964 1:44625282-44625304 CTCTTCTCTCCTCCAGCTCCTGG + Intronic
906624092 1:47310920-47310942 CTCACTGCACCTCCGCCTCCTGG + Intronic
907518391 1:55007647-55007669 AACTCGGGTCCTCTGGCTCCTGG - Intronic
907974264 1:59415624-59415646 CTCTGAGCTCCTGCAGCTCCTGG + Intronic
908951415 1:69567498-69567520 CTGCCGGCTCCTCCCGCTCGCGG - Intergenic
910402593 1:86852357-86852379 CTCTCCTTTCCTCCTGCTCCTGG - Intergenic
911706543 1:101020424-101020446 CTCCCTCCTCCTCTGGCTCCAGG + Intronic
911872785 1:103120280-103120302 CTCACTGCACCTCCGCCTCCTGG + Intergenic
912399683 1:109379561-109379583 CTCTGGGCTCCTCAGGGTACTGG - Intronic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
913644980 1:120847340-120847362 CTCACTGCACCTCCGCCTCCTGG + Intergenic
914045204 1:144085639-144085661 CACTCAGCTCCTGGGGCTCCTGG + Intergenic
914132906 1:144875047-144875069 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
914176655 1:145284745-145284767 CTCACTGCACCTCCGCCTCCTGG - Intergenic
914259357 1:145985840-145985862 CTCACTGCACCTCCGCCTCCCGG - Intergenic
914531382 1:148526224-148526246 CTCACTGCACCTCCGCCTCCGGG - Intergenic
914637010 1:149561516-149561538 CTCACTGCACCTCCGCCTCCTGG + Intergenic
915085068 1:153380904-153380926 TCCTCGGCTGCTCCGGCTTCCGG + Intergenic
915455563 1:156038300-156038322 CTCACTGCACCTCCGCCTCCCGG - Intronic
916748042 1:167699421-167699443 CCCTTGCCTCCTCTGGCTCCTGG + Intronic
918146438 1:181760059-181760081 CTCTCAGCTCCCCCTGCTCAGGG - Intronic
919103547 1:193122170-193122192 CCCTCGCCTCCGCCGGCTCGGGG - Exonic
921856597 1:219992850-219992872 ATCTTGGCGCCTCCGCCTCCTGG - Intronic
922794466 1:228333247-228333269 CTCTCAGCTCCTCCACCACCTGG - Exonic
922809232 1:228406693-228406715 CTCCCGGGTGCTCGGGCTCCGGG + Exonic
923051265 1:230392887-230392909 CTGTCTGCTCCTGCTGCTCCAGG - Intronic
924242874 1:242057254-242057276 CTCCCAGCTCCACCGGGTCCGGG - Intergenic
1063159282 10:3408132-3408154 CTCTTACCTCCTCCTGCTCCAGG - Intergenic
1063973644 10:11398225-11398247 CTCTGGGCTCCCCAGGCACCTGG - Intergenic
1064028268 10:11866735-11866757 CCCTCGGCTTCCCCGGCGCCAGG - Exonic
1066491303 10:35897833-35897855 CTGTCGGCTCCTCCAGGTCCTGG + Intergenic
1066710483 10:38228026-38228048 CTCTCCTTTCCTCAGGCTCCCGG - Intergenic
1066957319 10:42185332-42185354 CACTCAGCTCCTGGGGCTCCTGG + Intergenic
1066987009 10:42476354-42476376 CTCAAGGCTCCTGCCGCTCCCGG - Intergenic
1068414236 10:56697002-56697024 ATCTCAGCTCCTCCGCTTCCCGG - Intergenic
1069394983 10:67978199-67978221 ATCTCAGCTCCTCCATCTCCTGG - Intronic
1070015537 10:72526368-72526390 CTCACTGCACCTCCGCCTCCCGG + Intronic
1070289879 10:75107278-75107300 ATCTCTGCTCCTCCGCCTCCTGG - Intronic
1070591483 10:77805042-77805064 CTCACTGCACCTCCGCCTCCTGG + Intronic
1071549291 10:86554088-86554110 ATCTCGGCTCCTCTGCCTCCCGG + Intergenic
1071842338 10:89485438-89485460 CTAACGGCTCATCCTGCTCCAGG + Intronic
1072131522 10:92498680-92498702 CTCACTGCACCTCCGCCTCCCGG - Intronic
1072138606 10:92571052-92571074 CTCACTGCACCTCCGCCTCCTGG + Intronic
1072339804 10:94436208-94436230 CTCACTGCACCTCCGCCTCCTGG + Intronic
1073292683 10:102421186-102421208 CTCTCGGCCCCTCCGGTGCTCGG - Intronic
1073371637 10:102995101-102995123 CTCTCTGCTTTTCTGGCTCCTGG + Intronic
1073412108 10:103350887-103350909 CTCCCGGCTGCTCCGGCTCCCGG - Exonic
1074169751 10:110920052-110920074 CTCTCGGCTCCCTGGGCCCCCGG + Intronic
1074413449 10:113247125-113247147 CTCAAAGCTTCTCCGGCTCCTGG + Intergenic
1075124147 10:119686348-119686370 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1076156089 10:128206890-128206912 CTCTCAGCACTGCCGGCTCCTGG + Intergenic
1076721990 10:132396885-132396907 CTCTCGGGTCCTCCCGAGCCAGG + Intergenic
1076791587 10:132779561-132779583 CTCTCGGGTTCTCTGGATCCGGG + Intronic
1076916678 10:133425885-133425907 CATGCGGCTCCTCCGGCTGCGGG + Intergenic
1076936782 10:133570680-133570702 CATGCGGCTCCTCCGGCTGCGGG + Intergenic
1077385954 11:2269628-2269650 CGCTCGGCTCCGCGGGCTCCTGG + Intronic
1077446533 11:2593743-2593765 CTGTAGCCTCCTCCTGCTCCCGG + Intronic
1077475971 11:2790658-2790680 CTCTCAGCGCCTCAGCCTCCTGG + Intronic
1078225906 11:9391322-9391344 CTCACTGCACCTCCGCCTCCCGG - Intronic
1078477162 11:11640835-11640857 CTTTCAGCTCCTCCCACTCCTGG - Intergenic
1079128434 11:17734590-17734612 CGCGCGGCTCCTGCTGCTCCCGG - Intergenic
1079731828 11:23942777-23942799 CTCTCGGCTCCTCCTCTGCCTGG - Intergenic
1081124985 11:39311688-39311710 CTCTCGGCACCTCCGCTGCCTGG + Intergenic
1081901725 11:46634470-46634492 CTCACTGCACCTCCGCCTCCCGG + Intronic
1083864601 11:65446637-65446659 CTTTCGGCCCCTCTGTCTCCTGG - Intergenic
1083933432 11:65858127-65858149 CTCTCGTCTTCTGCGGCTCTCGG - Exonic
1084064611 11:66696477-66696499 CTCTCAGCTTCTCCGACACCAGG + Exonic
1084363211 11:68682722-68682744 CCCTCTGCTCCTCCGCCTCTCGG + Intergenic
1084633178 11:70370024-70370046 CTCACTGCACCTCCGCCTCCTGG + Intronic
1084732566 11:71082728-71082750 TTCTCCTCTCCTCCTGCTCCAGG - Intronic
1085040434 11:73323609-73323631 CTCCCAGCTCCTGCCGCTCCTGG + Intronic
1085119371 11:73957388-73957410 CCCTCCGCTCCTCCAGCACCTGG + Intronic
1085532616 11:77200992-77201014 CTCTGGGCTCCTGTGGCTCTGGG - Intronic
1088480714 11:110294318-110294340 CTCACTGCACCTCCGCCTCCTGG - Intronic
1089262388 11:117232075-117232097 GTCACTGCTCCTCCGGCTCCCGG - Exonic
1089581423 11:119483968-119483990 CTCCCGCCTCCTGCGGCTCTAGG + Intergenic
1089738400 11:120564957-120564979 CGATCGGCTCCGCCGGCTGCGGG + Intronic
1091143542 11:133257520-133257542 CTCTCTGCTCCTGTGGCCCCTGG + Intronic
1092732740 12:11549651-11549673 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1096003130 12:48145849-48145871 CTGCCTGCTCCTCCAGCTCCTGG - Exonic
1096291973 12:50351256-50351278 CTCTGGGCTCCTCTTTCTCCTGG - Exonic
1096365777 12:51027099-51027121 CTCACTGCACCTCCGCCTCCCGG - Intronic
1096575448 12:52549851-52549873 CTCTCTGCTCCTCCAGCCTCTGG - Intronic
1097246199 12:57609107-57609129 CTCTCAGCTCCTCTTGCACCCGG - Exonic
1097249513 12:57624859-57624881 CTCTTAGCTCCTCCAGGTCCCGG + Exonic
1098923776 12:76327149-76327171 CTCTCTGCACCTCCGCCTCCTGG - Intergenic
1099202464 12:79691333-79691355 CTCCCGGCGCCTCCGACTCCGGG + Intergenic
1100315575 12:93441763-93441785 CTCTCGCCTCCTTCGGCCCGCGG - Intronic
1102061482 12:109935474-109935496 CTCCTGGCTTCTCCGCCTCCCGG + Intronic
1102467206 12:113136866-113136888 CTCTCTGCTCCAGTGGCTCCAGG + Intergenic
1102766828 12:115440634-115440656 CTCCCAGGTCCTCCGGCTCCAGG + Intergenic
1102924922 12:116819370-116819392 CTCTGCGCGCCGCCGGCTCCGGG - Intronic
1103130615 12:118465235-118465257 CTCACAGCACCTCCGCCTCCCGG - Intergenic
1104779934 12:131413567-131413589 CCCTGGGCTCCTGCAGCTCCGGG + Intergenic
1104916407 12:132267154-132267176 CTCTCGGCTGCTCAAGCTCTGGG - Intronic
1104924701 12:132308161-132308183 CTCCCAGCTCCTGGGGCTCCAGG - Intronic
1105055904 12:133098948-133098970 ATCTTGGCTCATCCGCCTCCTGG + Intronic
1105454257 13:20525831-20525853 CTCGCAGCTCCGCCGGCGCCTGG - Exonic
1105809330 13:23980339-23980361 CCCGCGGCTCCTCCGTCGCCCGG - Intronic
1108641224 13:52384108-52384130 CTCACGGCAACTCCGCCTCCCGG - Intronic
1110450821 13:75636199-75636221 CCCTTGGCTCCCCGGGCTCCCGG - Intronic
1110815096 13:79852446-79852468 CTCACTGCACCTCCGTCTCCCGG - Intergenic
1113485549 13:110650009-110650031 CTCACTGCACCTCCGCCTCCTGG + Intronic
1113660911 13:112105709-112105731 CCGACGGCTCCTCCGGCGCCTGG - Intergenic
1113813900 13:113158816-113158838 CTCAGGGCTCCTCTGGCTCCTGG - Intronic
1114349788 14:21836908-21836930 TTCTCCGCTCCTCCACCTCCCGG + Intergenic
1115365559 14:32553234-32553256 CTCACTGCACCTCCGCCTCCTGG + Intronic
1116497126 14:45574730-45574752 CTCTCTTGTCCTCTGGCTCCTGG + Intergenic
1116607064 14:47013868-47013890 CTCACTGCACCTCCGCCTCCTGG + Intronic
1117145586 14:52833868-52833890 CTGCCGGCTCGCCCGGCTCCAGG + Intergenic
1117416815 14:55504439-55504461 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
1117449743 14:55839369-55839391 CTCTCGGCGCCTCCGCTGCCTGG + Intergenic
1117520487 14:56546626-56546648 CTCTCTGCTGTTCAGGCTCCTGG - Intronic
1118259502 14:64234303-64234325 CCCTCCCCTCCTCCAGCTCCAGG + Intronic
1118780620 14:69005389-69005411 CCCTTGCCTCCTCCAGCTCCTGG + Intergenic
1121564026 14:94895259-94895281 CTCTCTGCTCCTCTGTTTCCCGG + Intergenic
1122142603 14:99671871-99671893 CTCTCTGCCCCTCTGGTTCCTGG - Intronic
1202935781 14_KI270725v1_random:86448-86470 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1123552728 15:21398412-21398434 GTGTCTGCTCCACCGGCTCCTGG - Intergenic
1123588974 15:21835800-21835822 GTGTCTGCTCCACCGGCTCCTGG - Intergenic
1125669177 15:41457456-41457478 ATCTCAGCTCCTCCACCTCCCGG - Intronic
1125767839 15:42146989-42147011 CTCTCGGCTCCCCTGGGGCCAGG - Intronic
1127262155 15:57334481-57334503 CTCCCGGCTCCTCCCTCTCCTGG - Intergenic
1127868072 15:63048073-63048095 CGCTCAGCTTCTCTGGCTCCCGG + Intronic
1129037975 15:72662442-72662464 CTCTCTGCACCTCCTGCTCTCGG - Exonic
1129211914 15:74074789-74074811 CTCTCTGCGCCTCCTGCTCTCGG + Exonic
1129296600 15:74603472-74603494 GTCTCAGCTCCTCCAGCTCCTGG + Intronic
1129398489 15:75266295-75266317 CTCTCTGCGCCTCCTGCTCTCGG - Exonic
1129402097 15:75290571-75290593 CTCTCTGCGCCTCCTGCTCTCGG - Exonic
1129942146 15:79507452-79507474 CTTTCAGCTTCTCCAGCTCCTGG - Intergenic
1131428151 15:92364101-92364123 CTCTCAGCTCCTCCACCTTCGGG - Intergenic
1132365069 15:101251366-101251388 CTCGCGGCTCGTCCTGCCCCGGG - Exonic
1132415951 15:101619023-101619045 CTCTGAGCTCCCTCGGCTCCAGG - Intergenic
1202961078 15_KI270727v1_random:125632-125654 GTGTCTGCTCCACCGGCTCCTGG - Intergenic
1133973064 16:10580714-10580736 CACTCGGCTCTCCCGGCTCCTGG - Intergenic
1134110637 16:11513503-11513525 CTCACTGCACCTCCGCCTCCCGG + Intronic
1134816368 16:17209164-17209186 CTCTCCCCTCCTTCAGCTCCTGG + Intronic
1134834652 16:17350801-17350823 CTCTCCGTTCTTCCGGCTCTGGG - Intronic
1135743915 16:24999488-24999510 CTCACTGCAGCTCCGGCTCCTGG + Intronic
1135783246 16:25324792-25324814 GTCTCAGCTCCCCTGGCTCCAGG - Intergenic
1135978570 16:27128257-27128279 ATCTCAGCTCCTCTGTCTCCCGG - Intergenic
1136120487 16:28130015-28130037 CTCTGTGCTGCTCTGGCTCCTGG - Intronic
1136153008 16:28364604-28364626 CCCTCGCCTCCTCTGGCTGCGGG + Intergenic
1136210075 16:28750669-28750691 CCCTCGCCTCCTCTGGCTGCGGG - Intergenic
1138058380 16:53860588-53860610 CTCTCTCTTCCTCCTGCTCCGGG - Intronic
1138441788 16:57039814-57039836 CCTTCTGCTCCTCTGGCTCCTGG - Exonic
1139459504 16:67110358-67110380 CTCTCGGCTCGCTGGGCTCCAGG + Intronic
1140404586 16:74700413-74700435 CCCTCGGCCCCGCCGCCTCCTGG + Intronic
1142243694 16:88958786-88958808 CTCTGGGCTCTTCCCGCTGCAGG + Intronic
1142268795 16:89078330-89078352 CTCTGGGCTCATCCTGCTGCGGG - Intergenic
1142761905 17:2047458-2047480 CTCACTGCACCTCCGTCTCCTGG + Intergenic
1142791863 17:2272861-2272883 AACTCAGCTCCTCCGCCTCCTGG - Intronic
1143258932 17:5584144-5584166 CTCTGGGCTCCTCCCTCCCCTGG - Intronic
1143951776 17:10638327-10638349 CGCTCAGCTCCTCCAGCTCCCGG + Exonic
1143994236 17:10993009-10993031 CTCTCGCCTCCTCTGGCACAAGG + Intergenic
1145021486 17:19435069-19435091 CTCACTGCACCTCCGCCTCCTGG + Intergenic
1146382644 17:32342207-32342229 ATCAGGGCTCGTCCGGCTCCCGG + Intronic
1147284757 17:39392924-39392946 ATCTCGGCTCCTCCGCCTCCTGG - Intronic
1147745348 17:42691327-42691349 CACTCAGCTCCTCCCACTCCCGG - Intronic
1148615146 17:48996123-48996145 ATTCCGGATCCTCCGGCTCCCGG - Intergenic
1149113428 17:53062577-53062599 CTCACTGCGCCTCCGCCTCCCGG + Intergenic
1149759216 17:59214482-59214504 CTCACTGCACCTCCGCCTCCTGG + Intronic
1150354262 17:64469762-64469784 CTGTGGGCTCCTCTGGCTCCTGG + Intergenic
1151235560 17:72717441-72717463 CCCTCGGCTCTTCCAGCTTCTGG + Intronic
1151343018 17:73484092-73484114 CTCCCCGCTCCTCCGGCTCGGGG + Intronic
1151732150 17:75917896-75917918 CTCTCAGCCACCCCGGCTCCTGG - Intronic
1152635770 17:81429951-81429973 CGGGCGGCTCCTCCAGCTCCGGG - Intronic
1152661564 17:81544715-81544737 CTCTGGGCTCCCCAGGCCCCTGG - Intronic
1152827479 17:82476516-82476538 ATCTCGGCTCCTCTGCCTCCTGG + Intronic
1152859732 17:82689211-82689233 CTCACTGCTCCTCCTGCCCCAGG - Intronic
1153278874 18:3395346-3395368 CCCTGGGATCCTCCAGCTCCAGG - Intergenic
1153514319 18:5890734-5890756 CCTCGGGCTCCTCCGGCTCCCGG + Exonic
1153618899 18:6957853-6957875 CTCACTGCACCTCCGCCTCCCGG + Intronic
1153682305 18:7512094-7512116 CTCTGGGGTCCTGCGGCTCCTGG + Intergenic
1153820168 18:8825595-8825617 CTGTCTGCTCCTAAGGCTCCGGG - Exonic
1155196895 18:23484107-23484129 ATCTCAGCTCCTCTGCCTCCTGG - Intronic
1156829075 18:41468745-41468767 CTCTGGCCTCCTGGGGCTCCAGG + Intergenic
1157776723 18:50402005-50402027 CTCCCGGCTCCTGCGCCTTCAGG + Intergenic
1157870453 18:51225734-51225756 CTCTCTACTCCTCCTGCTCAAGG + Intergenic
1158985221 18:62808624-62808646 CTCACTGCACCTCCGCCTCCTGG + Intronic
1160410677 18:78673623-78673645 AGCTCTGGTCCTCCGGCTCCGGG - Intergenic
1160550939 18:79693629-79693651 ATCTGAGCTCCTCCGGGTCCTGG - Intronic
1160754863 19:751785-751807 ATCTCAGCTCCTTGGGCTCCTGG - Intronic
1160810742 19:1011992-1012014 CTCACGGCTCCTTCTGCTGCAGG - Exonic
1160847626 19:1173490-1173512 CTCCCCGCCCCTCCCGCTCCTGG - Intronic
1161624866 19:5320358-5320380 CACTTGGCTTATCCGGCTCCCGG + Intronic
1161712796 19:5859252-5859274 ATATTGGCTCCTCCGCCTCCTGG + Intergenic
1161808680 19:6459422-6459444 CTCCCGGCCCCGCCCGCTCCCGG - Intronic
1162301426 19:9847293-9847315 CCCTGGCCTCCTCCGCCTCCTGG + Intronic
1162572530 19:11481333-11481355 CTGTTGGCTCCTCCAGCTCTAGG - Intronic
1162778660 19:12995640-12995662 AGCTCGGCCCCGCCGGCTCCGGG - Exonic
1162779658 19:13000417-13000439 CTCTTGCCTCCTCCTCCTCCAGG - Intronic
1163030002 19:14537818-14537840 CTCGCTGCACCTCCGCCTCCCGG + Intronic
1163756209 19:19107804-19107826 CTCTCGGCTCCTCCCGAAGCCGG - Intronic
1164109132 19:22138088-22138110 CTCCCGGCTGCTCCGGCTCCCGG + Intergenic
1165107603 19:33481944-33481966 CTCACTGCACCTCCGCCTCCTGG - Intronic
1165597926 19:37026392-37026414 CTCACTGCACCTCCGCCTCCTGG + Intronic
1165744544 19:38222835-38222857 CTCTCCCCTCCTCCCACTCCGGG + Intronic
1165827572 19:38714033-38714055 CACTAGGCTCCTCCGGGACCCGG + Intronic
1165940480 19:39412712-39412734 CTCTGGACCCCTCGGGCTCCCGG - Exonic
1167292740 19:48633443-48633465 CCTTCTGCTCCTCCGGCACCTGG + Exonic
1167626781 19:50595564-50595586 CTCACTGCTGCTCCGCCTCCCGG + Intergenic
1167682430 19:50932246-50932268 CTCCCTGCTCCTCAGCCTCCTGG + Intergenic
1168210204 19:54884555-54884577 ATCTCAGCTCCTCCGCCTCCCGG - Intronic
1168282450 19:55312708-55312730 CACACAGGTCCTCCGGCTCCAGG + Intergenic
1202684762 1_KI270712v1_random:39043-39065 CACTCAGCTCCTGGGGCTCCTGG + Intergenic
925061383 2:893509-893531 CTCTCAGCTCCTCCCACCCCAGG + Intergenic
925061407 2:893600-893622 CTCTCGGCTCCTCCCACCCAAGG + Intergenic
925369590 2:3335108-3335130 CTCTCGCCTCATGTGGCTCCTGG - Intronic
926035117 2:9630510-9630532 CTCGAGGCTCCTCCCGCTGCGGG - Exonic
927145585 2:20163498-20163520 CTCACTGCACCTCCGCCTCCTGG - Intergenic
927870999 2:26623711-26623733 CTCTTCCCTCCTCCTGCTCCGGG - Intronic
928022526 2:27715782-27715804 CTCTCGCCTCCTCCCGCCCCGGG - Intergenic
928987681 2:37196850-37196872 GCCTCCGCTCCCCCGGCTCCCGG - Intronic
931317277 2:61144568-61144590 CTCACTGCACCTCCGCCTCCCGG - Intergenic
932356070 2:71069139-71069161 CTCGCAGCTGCTCCAGCTCCCGG - Intronic
932416601 2:71577094-71577116 CTCTCTGGTCCTCCAGCTGCAGG - Intronic
933666818 2:84971149-84971171 CTCTCGGGCCTGCCGGCTCCCGG - Exonic
933760310 2:85667935-85667957 CTCTGGGTTCCACCTGCTCCTGG + Intronic
934246956 2:90315803-90315825 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
934262369 2:91486800-91486822 CACTCAGCTCCTGGGGCTCCTGG + Intergenic
934305419 2:91817789-91817811 CACTCAGCTCCTGGGGCTCCTGG + Intergenic
934327837 2:92034959-92034981 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
934466227 2:94265498-94265520 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
934576568 2:95405509-95405531 CTCTGGGATCCTCTGTCTCCTGG + Intronic
934638791 2:96013680-96013702 CTCTGGGATCCTCCGTCTCCTGG + Intergenic
937757385 2:125556775-125556797 CTCTCTGTTTCTCCTGCTCCGGG + Intergenic
940835938 2:158522612-158522634 ATCTTGGCTCCTCCCCCTCCAGG - Intronic
941712200 2:168725397-168725419 CTCTCGGCGCCTCCTGTGCCTGG - Intronic
943264738 2:185714416-185714438 ATCTTGGCTCCTCTGCCTCCTGG + Intergenic
945919192 2:215738046-215738068 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
945988162 2:216371437-216371459 CGCCCTCCTCCTCCGGCTCCGGG + Exonic
946072846 2:217049050-217049072 CTCTCAGCTCCTCCATCCCCTGG + Intergenic
946622377 2:221573346-221573368 CGCCCGGCTGCTCCGGCCCCGGG + Intronic
947301002 2:228688744-228688766 CTCTCGGCTCCCCCGATCCCTGG + Intergenic
947992225 2:234496924-234496946 CTCTCCGCTCTCCCGGCGCCCGG + Exonic
948826467 2:240575573-240575595 CGCTCTGCTCCTTCAGCTCCGGG - Exonic
948843685 2:240672767-240672789 CGCGCGGCTCCAGCGGCTCCGGG - Intergenic
948992761 2:241563152-241563174 CTCCCTGCTCCTGCTGCTCCCGG + Intronic
949001356 2:241616000-241616022 CTCTGGGCTGCTCCAGCTGCAGG - Intronic
1168831049 20:845434-845456 CTCTCGCCTCCTCCGGGTCCAGG - Exonic
1169136946 20:3203330-3203352 CTCTCGGCTCCTCAGGCTCCAGG + Exonic
1171459225 20:25289189-25289211 CTCTGGGCTCCGCCACCTCCTGG + Intronic
1172330755 20:34074724-34074746 CTCCAGGCTCCTCCAGCTCTGGG + Intronic
1173561739 20:44010970-44010992 CTCGCTTCTCCTCCGGCTCCTGG + Intronic
1173822998 20:46030713-46030735 CTCTGAGGTCCTCCGGATCCTGG + Intronic
1174075421 20:47932043-47932065 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1176820541 21:13651496-13651518 GTGTCTGCTCCACCGGCTCCTGG + Intergenic
1179054131 21:37916073-37916095 CTCGCGGCTGCTCCGGCTCCAGG + Exonic
1179887166 21:44319103-44319125 CTCTCAGCAGCTCCAGCTCCAGG - Intronic
1179946676 21:44682853-44682875 TTCTCTGCTCCTCGGACTCCAGG - Intronic
1180280130 22:10686124-10686146 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1180587350 22:16904656-16904678 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1180590588 22:16933964-16933986 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1180693711 22:17738821-17738843 CTCTCAGCTCCTACCGCTACAGG + Intronic
1182572329 22:31248602-31248624 CTCCCGGCACCTCTGGCTGCAGG - Exonic
1182744630 22:32596111-32596133 CTCTCTCTTCCTCCTGCTCCAGG + Intronic
1183185509 22:36289371-36289393 CTCTGGGCTCCTCCTTCCCCAGG - Intronic
1183258195 22:36776588-36776610 CTCGCGGCTTCCCCGGTTCCCGG + Intergenic
1183322267 22:37172358-37172380 CACTCGGCTCCATCAGCTCCTGG + Intronic
1183359780 22:37377436-37377458 CTCTCTCCTCCTCCTCCTCCTGG + Intronic
1183420420 22:37708764-37708786 ATCCTGGCTCCTCCGGTTCCCGG - Intronic
1183579684 22:38716500-38716522 CACTGTGCTCCTCCGGCTCAAGG + Intronic
1183685136 22:39357398-39357420 CTCTCGGCTCCTCCTCTGCCTGG + Intronic
1183909475 22:41067706-41067728 CTCTGTGCTCCTACAGCTCCTGG + Intergenic
1184796670 22:46737216-46737238 CTCACTGCACCTCCGCCTCCTGG - Intronic
1184960893 22:47927716-47927738 ATCTTTGCTCCACCGGCTCCCGG - Intergenic
1185032253 22:48450280-48450302 CTCTCTGCTTCCCCAGCTCCAGG - Intergenic
1185247669 22:49781640-49781662 ACCTCGGCTTCTCCGGCTCATGG + Intronic
1185255159 22:49827640-49827662 CTCTCGGCCGCGGCGGCTCCGGG + Intergenic
950152203 3:10696556-10696578 CTGTAGCCTCCTCTGGCTCCTGG + Intronic
952838452 3:37624679-37624701 CTCACTGCACCTCCGCCTCCTGG + Intronic
954276903 3:49548164-49548186 CTCTTGGCTCCTCCAGGTTCTGG - Intergenic
954750630 3:52811460-52811482 CTCTGGGCTCCTGCAGCACCTGG + Intergenic
955449240 3:59049781-59049803 TTCTCAGCCCCTCCGGCCCCTGG + Intronic
955485731 3:59432980-59433002 CTCTCGGCTCCTCCTCCTCCCGG - Intergenic
956296460 3:67720060-67720082 CTCACTGCACCTCCGCCTCCTGG + Intergenic
956414679 3:69013573-69013595 TTCACGGCTGCCCCGGCTCCAGG - Exonic
958798860 3:98733321-98733343 CTCTCGGCCCCCACGGCTCCTGG - Intronic
958941232 3:100317006-100317028 CTCACTGCACCTCCGCCTCCTGG - Intronic
959163077 3:102742630-102742652 ATCTTGGCTCCTCTGCCTCCCGG + Intergenic
961219423 3:125187897-125187919 CTCTGGGCTCCTCCAGTGCCAGG + Intronic
962130526 3:132669339-132669361 CTCACTGCACCTCCGCCTCCCGG + Intronic
962352175 3:134664094-134664116 CTCTGGCCTCCTCCGGCATCTGG + Intronic
963798838 3:149657696-149657718 CTCCAGGCTCCTCGGGCTTCCGG - Intronic
965170275 3:165254071-165254093 CTCACTGCACCTCCGCCTCCAGG - Intergenic
966413307 3:179665011-179665033 CTCACTGCACCTCCGCCTCCTGG - Intronic
967027607 3:185578442-185578464 CTCACCGCACCTCCGCCTCCTGG + Intergenic
968258155 3:197297899-197297921 CGCTCGGCTCCGCGGGCCCCGGG - Intronic
968447995 4:662118-662140 CTCTCGGCTCCCCCAGGTCCTGG + Exonic
968661357 4:1800072-1800094 CCCTGGCCTCCTCCTGCTCCTGG - Intronic
968946246 4:3665950-3665972 CTCTGTGCTCCTGCAGCTCCAGG - Intergenic
969364412 4:6685863-6685885 CTCTCAACTCCTCCTCCTCCAGG + Intergenic
972975495 4:44630041-44630063 ATCTCAGCTCCTCCGCCTCCTGG + Intronic
973015056 4:45127682-45127704 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
973316568 4:48766600-48766622 CTCTCGGTTCCTCCTACTCAGGG - Intronic
973789344 4:54364045-54364067 CTCTCTGCTCCTCCGCCTGAGGG - Intergenic
975144286 4:70950359-70950381 ATCTTGGCTCATCCGCCTCCTGG - Intronic
979930084 4:126619074-126619096 CTCACTGCACCTCCGCCTCCTGG + Intergenic
982357777 4:154489459-154489481 CTTTCAGCTCCACCGCCTCCTGG + Intronic
983579355 4:169292314-169292336 CTCACTGATCCTCCGCCTCCAGG - Intergenic
985641776 5:1066777-1066799 CTCCTGCCTCCTCCAGCTCCTGG - Intronic
985683733 5:1270968-1270990 CCCCCGCCCCCTCCGGCTCCTGG - Intronic
985855173 5:2418683-2418705 CTCTCGTCTGCTCCAGCGCCAGG + Intergenic
986975380 5:13387868-13387890 ATCTCAGCTACTCCAGCTCCAGG + Intergenic
997234981 5:132267512-132267534 CTCTGGGCTCCTTTGGCCCCTGG - Intronic
998055673 5:139074897-139074919 CTCACTGCACCTCCGCCTCCCGG + Intronic
998282978 5:140830014-140830036 CTCTCCGCGCCACCGGCTGCTGG + Exonic
999307912 5:150532599-150532621 CTCACTGCACCTCCGCCTCCCGG + Intronic
1000066795 5:157700308-157700330 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1001379032 5:171290292-171290314 CTCACTGCACCTCCGCCTCCCGG - Intronic
1001628608 5:173158031-173158053 ATCTTCGCTCCTCCGCCTCCTGG + Intronic
1001999632 5:176190455-176190477 CTCTCCCCTCCCCCGGCCCCTGG - Intergenic
1003074571 6:2971697-2971719 CTCGCGGCCCCTCCGGCTGGCGG - Intronic
1003908057 6:10720459-10720481 CTCTCGGCGCCTCCTCTTCCTGG + Intergenic
1004709363 6:18155392-18155414 CTGTCGGCTCCTCCCACCCCGGG + Intronic
1005450347 6:25965844-25965866 CTCACTGCACCTCCGCCTCCCGG - Intronic
1005728954 6:28677003-28677025 CTCACTGCTCCTCCACCTCCCGG - Intergenic
1005934783 6:30512557-30512579 CTCACTGCGCCTCCGCCTCCCGG - Intergenic
1006052657 6:31356242-31356264 CTCTCCGCTGCTCCGCCTCACGG + Exonic
1006071256 6:31499206-31499228 CTCCCCTCGCCTCCGGCTCCGGG + Intronic
1006357390 6:33567943-33567965 CGCTCGGCTGCTCTGGCTCGGGG - Intergenic
1006944683 6:37777575-37777597 CTCCCCGCTCCTCCAGCTTCAGG - Intergenic
1007655643 6:43449648-43449670 ATCTCAGCTCCTCCTTCTCCAGG + Intronic
1009397725 6:63220251-63220273 ATCTCGGCTCCTCCACCTCCTGG + Intergenic
1009615012 6:65992536-65992558 CTCTCTCCTCCTCCTGCTCTGGG - Intergenic
1010363889 6:75027417-75027439 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1013646281 6:112144827-112144849 CTCTCGGATCCTCTGGATGCTGG + Exonic
1014598386 6:123374699-123374721 CTCACTGCACCTCCGCCTCCTGG - Intronic
1016517658 6:144913255-144913277 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1016975899 6:149807443-149807465 CTCACTGCACCTCCGCCTCCTGG + Intronic
1019392168 7:794737-794759 CTCTGGGCTCCTCCTGCCCCCGG - Intergenic
1019421699 7:953974-953996 CTGTGGGGTCCGCCGGCTCCGGG - Intronic
1019699442 7:2467220-2467242 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1019748185 7:2712374-2712396 CTGACGGCTCCCCCGCCTCCTGG - Exonic
1019975056 7:4574466-4574488 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
1021225739 7:18023744-18023766 CTCACTGCACCTCCGCCTCCTGG - Intergenic
1023081599 7:36531992-36532014 CTCTCGGCTCCTCAAGCACCTGG + Intronic
1023725771 7:43141571-43141593 CTCACCGCGCCTCCGCCTCCTGG + Intronic
1023881843 7:44325274-44325296 CCCTCCGCGCCGCCGGCTCCAGG - Intronic
1026280746 7:68919789-68919811 CTCTCTCTTCCTCCTGCTCCAGG - Intergenic
1026522875 7:71132010-71132032 CTCACAGCGCCGCCGGCTCCCGG - Intergenic
1026589550 7:71683129-71683151 CTCATGGCTCCCCCGGCTCTGGG + Intronic
1026744609 7:73001271-73001293 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1027030717 7:74885936-74885958 CTCACTGCACCTCCGCCTCCCGG - Intergenic
1027099128 7:75363821-75363843 CTCACTGCACCTCCGCCTCCCGG + Intergenic
1027261919 7:76470929-76470951 TCCTCGGCTCCACCAGCTCCCGG + Intronic
1027313301 7:76969028-76969050 TCCTCGGCTCCACCAGCTCCCGG + Intergenic
1028877327 7:95837979-95838001 ATCTTGGCTCCTCCTGGTCCTGG + Intronic
1029281669 7:99439356-99439378 CTCCCACCTCCTCCGGGTCCTGG + Intronic
1029400228 7:100340601-100340623 CTCACTGCACCTCCGCCTCCCGG + Intronic
1031001613 7:116421918-116421940 CTCACTGCACCTCTGGCTCCCGG - Intronic
1032475988 7:132211816-132211838 ATCTGGGCTCCTGTGGCTCCAGG - Intronic
1033331135 7:140417775-140417797 CCCTCGCCTCCTCTGGCTTCTGG + Intronic
1035734546 8:1878680-1878702 CTCTCGGCTCCTCAGTGGCCTGG - Intronic
1035909828 8:3554427-3554449 TTCTCTGCTCCCCCAGCTCCAGG - Intronic
1036701281 8:11015599-11015621 CTCTGGGCTTCTCCGGCCTCAGG + Intronic
1036772960 8:11591713-11591735 CTCTCATCTCCTCTGGCCCCAGG - Intergenic
1037769481 8:21789978-21790000 CTCCCGGCTCCCTAGGCTCCGGG + Intronic
1037865697 8:22440914-22440936 CTCTCGGCTCCTCCGGCTCCGGG - Intronic
1039975719 8:42363047-42363069 CTCACCGCACCTCCGTCTCCTGG - Intronic
1042600242 8:70492589-70492611 CTCTCTGCACCTCTGCCTCCTGG + Intergenic
1042936906 8:74068868-74068890 CTCACGCATCCTCCGCCTCCGGG + Intergenic
1044729781 8:95220524-95220546 CTCCCTGCTCCTCCTGCTCCTGG + Intergenic
1044934195 8:97277622-97277644 CGCGCAGCTCCTCCGGCTCGGGG - Exonic
1045702448 8:104882346-104882368 ATTTCGGCTCCTCTGCCTCCTGG + Intronic
1046621142 8:116530950-116530972 CTCTCGGCTCCTCCTCTGCCTGG + Intergenic
1046871288 8:119208366-119208388 CGCTCAGCTCCGCGGGCTCCGGG - Exonic
1047038108 8:120962097-120962119 ATCTCCTCTCCTCCAGCTCCAGG + Intergenic
1048979065 8:139693469-139693491 CTCTCAGCTGCTCCTGCTCTCGG + Intronic
1049245106 8:141558207-141558229 CTCTCAGCTCCCCTGGGTCCTGG - Intergenic
1049549798 8:143251932-143251954 CTCCCGGCTGCTCCTGCTGCTGG + Intronic
1049778368 8:144416485-144416507 CACTAGCCTCCTCCGCCTCCTGG + Intronic
1051637644 9:19195409-19195431 CTCACCGCACCTCCGCCTCCTGG - Intergenic
1051936288 9:22446869-22446891 CTCTCAGCGTCTCCAGCTCCAGG + Exonic
1053410393 9:37912787-37912809 ATCTTGGCTCCTCCGCCTCCTGG + Intronic
1053696276 9:40642270-40642292 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1054307527 9:63441498-63441520 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1054406255 9:64765500-64765522 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1054439882 9:65250973-65250995 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1054490524 9:65770966-65770988 CACTCAGCTCCTGGGGCTCCTGG + Intergenic
1054831540 9:69630657-69630679 CTCTCTGCTCCTCTGGCACACGG + Intronic
1057393156 9:94655882-94655904 CTCCTGCCTCCTCCAGCTCCAGG - Intergenic
1057423225 9:94928442-94928464 CCCTCAGCTCCTGCTGCTCCCGG - Exonic
1057477060 9:95411786-95411808 CTCACGGTCCCTCCGCCTCCAGG - Intergenic
1057478652 9:95426827-95426849 CTCTGGGCGGCCCCGGCTCCCGG + Intergenic
1059043682 9:110841815-110841837 CTCTCTGCCCCACCAGCTCCTGG - Intergenic
1059163088 9:112053438-112053460 CTCACTGCACCTCCGCCTCCTGG - Intronic
1060385704 9:123226210-123226232 CTCTCTTCACCTCCTGCTCCTGG - Intronic
1060660096 9:125400158-125400180 TTCTCGGCTCTTCTGGTTCCTGG + Intergenic
1060904696 9:127294376-127294398 CTCACTGCACCTCCGCCTCCTGG + Intronic
1061207987 9:129175333-129175355 CTCTCGGCCGCCCCCGCTCCAGG - Intergenic
1061222142 9:129258495-129258517 CTCCCGGCCCCTCCTGCTCCGGG + Intergenic
1061247386 9:129407595-129407617 CTCTGGGCTCTGTCGGCTCCTGG + Intergenic
1061422163 9:130478343-130478365 CTCACGGCTCTCCAGGCTCCTGG - Intronic
1061992146 9:134165168-134165190 CTCGCGTGTCCTCCGGCTCCAGG + Intergenic
1062286983 9:135777738-135777760 CCCCCAGCTCCTCTGGCTCCTGG + Intronic
1062414979 9:136443893-136443915 CTCTGTGCTTCTCAGGCTCCTGG - Exonic
1062500631 9:136850525-136850547 CTCTGGGCGCCTCAGGCCCCAGG + Intronic
1062526287 9:136979270-136979292 CCCTCGGCTCCTACAGCTACCGG + Exonic
1202778724 9_KI270717v1_random:15931-15953 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1203526709 Un_GL000213v1:97425-97447 GTGTCTGCTCCACCGGCTCCTGG - Intergenic
1185522077 X:747835-747857 CTCTCTGAACCTCCGCCTCCCGG - Intergenic
1185543925 X:926552-926574 CTCCCAGCTCCTGGGGCTCCAGG + Intergenic
1185693928 X:2179740-2179762 CCTCCGCCTCCTCCGGCTCCTGG + Intergenic
1187098630 X:16170312-16170334 CACTCTGTTCCTCCTGCTCCAGG + Exonic
1191116651 X:56859925-56859947 GTCACCGCTCCTCCAGCTCCAGG - Intergenic
1193417386 X:81241063-81241085 CTCTGGCCTCTTCCCGCTCCTGG + Intronic
1195306091 X:103585572-103585594 GTCTCGTCTGCTCCGGTTCCTGG + Exonic
1195577453 X:106467635-106467657 CTCCTGGGTCCTCCTGCTCCCGG + Intergenic
1195966856 X:110436819-110436841 CTCTCAGCTCCTCAGGCTGCTGG - Intronic
1196859684 X:120015451-120015473 CGCTGGGGTCCTCTGGCTCCTGG + Intergenic
1198261938 X:134972853-134972875 CTCTCTCTTCCTCCTGCTCCAGG + Intergenic
1200070233 X:153525625-153525647 GTCCTGGCTCCTCTGGCTCCTGG + Intronic
1201194026 Y:11474199-11474221 CACTCAGCTCCTGGGGCTCCTGG - Intergenic
1201899513 Y:19034621-19034643 ATCTTGGCTCCTGCGGCTTCTGG - Intergenic
1202128821 Y:21591992-21592014 CTGTCAGCTCCTCAGGCTGCAGG - Intergenic