ID: 1037865862

View in Genome Browser
Species Human (GRCh38)
Location 8:22441503-22441525
Sequence CCGAGCCGCCGCCCAGCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 96}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037865862_1037865871 -6 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865871 8:22441520-22441542 GCTCGGGGCGGAGGGAGGCTGGG 0: 1
1: 0
2: 2
3: 48
4: 416
1037865862_1037865883 29 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865883 8:22441555-22441577 CCACCCTAGGAGGGCTCGGAGGG 0: 1
1: 0
2: 1
3: 5
4: 100
1037865862_1037865873 -1 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865873 8:22441525-22441547 GGGCGGAGGGAGGCTGGGGCCGG 0: 1
1: 1
2: 22
3: 310
4: 2690
1037865862_1037865877 19 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865877 8:22441545-22441567 CGGGCTGCGCCCACCCTAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 101
1037865862_1037865884 30 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 94
1037865862_1037865878 20 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865878 8:22441546-22441568 GGGCTGCGCCCACCCTAGGAGGG 0: 1
1: 0
2: 0
3: 17
4: 151
1037865862_1037865875 16 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865875 8:22441542-22441564 GGCCGGGCTGCGCCCACCCTAGG 0: 1
1: 0
2: 2
3: 23
4: 225
1037865862_1037865881 28 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865881 8:22441554-22441576 CCCACCCTAGGAGGGCTCGGAGG 0: 1
1: 0
2: 1
3: 19
4: 158
1037865862_1037865872 -5 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865872 8:22441521-22441543 CTCGGGGCGGAGGGAGGCTGGGG 0: 1
1: 1
2: 2
3: 40
4: 661
1037865862_1037865870 -7 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865870 8:22441519-22441541 GGCTCGGGGCGGAGGGAGGCTGG 0: 1
1: 0
2: 7
3: 84
4: 979
1037865862_1037865874 0 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865874 8:22441526-22441548 GGCGGAGGGAGGCTGGGGCCGGG 0: 1
1: 1
2: 8
3: 184
4: 1541
1037865862_1037865879 25 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865879 8:22441551-22441573 GCGCCCACCCTAGGAGGGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037865862 Original CRISPR CCGAGCCGCCGCCCAGCCGA AGG (reversed) Intronic
900109740 1:1000399-1000421 CCGAGACTCCGCCCAGCCCCGGG - Intergenic
900116909 1:1032949-1032971 CCTGGCCGCTGCCCAGCCGGGGG - Intronic
900898533 1:5501397-5501419 CCCAGCCGCCGCCCAGCCTCTGG + Intergenic
901871486 1:12141324-12141346 CCTGGCCTCCGCCCAGCTGATGG - Intronic
904837657 1:33349642-33349664 GCGAGTCGGCGCCCGGCCGAGGG - Intronic
905789916 1:40784267-40784289 CCGAGCCGGAGCCCGGCCCAGGG - Exonic
906365344 1:45205777-45205799 CGGAGCCGCTGTCCAGCAGACGG + Exonic
907486396 1:54781182-54781204 CCCAGGCCCCGCCCAGCTGATGG - Exonic
910935042 1:92480624-92480646 AGGAGCCGCCGCCCAGCAGCAGG + Exonic
914702745 1:150149707-150149729 CCGAGCCGCCGCCGGAGCGAGGG + Intronic
920027232 1:203007662-203007684 CCGAGCCGCCCTCCAGCCGCGGG - Intronic
1062932171 10:1360624-1360646 CCCAGCCCCCGCCCAGCTGTGGG + Intronic
1076892031 10:133289647-133289669 CAGCGCCGCAGCCCAGCCCACGG + Intronic
1080223551 11:29934432-29934454 CCGAGCCTACCCCCAGCCGTGGG + Intergenic
1084562540 11:69912785-69912807 CCGAGCCACAGCCCTGCCGTGGG + Intergenic
1088172775 11:107017637-107017659 CCGGGCCGCCCCCCAGCGGTCGG + Intronic
1088758512 11:112907306-112907328 CCGAGCCCAGGCCCAGGCGAGGG + Intergenic
1091434152 12:460310-460332 CCGAGCCGCCGCCCCCCGGCCGG - Intergenic
1091705757 12:2691800-2691822 CCGAGCTCCCGGCCAGCCGCCGG + Intronic
1092133953 12:6132708-6132730 CGGAGCGGCCGGCCAGCCGCGGG + Intergenic
1097166558 12:57089297-57089319 CCGAGCAGCCGCCGGGCGGAGGG + Exonic
1097889085 12:64759342-64759364 GCGAGAGGCCGACCAGCCGAAGG + Exonic
1108382716 13:49869455-49869477 CCAAGCCGCAGCCCAGCCAAAGG - Intergenic
1109638062 13:65149672-65149694 CCGAGCCTCCCCACCGCCGAGGG - Intergenic
1113727746 13:112617849-112617871 CAAAGCCGCCTCCCAGCCCACGG - Intergenic
1113914438 13:113862389-113862411 CGGAGTCGCCGCCCAGCTGTGGG - Intronic
1117478109 14:56118155-56118177 CCGAGCCTCCGCCGGGCCGAGGG + Intronic
1122065970 14:99174796-99174818 CCGCGCCGCTGCCCAGCCCCGGG - Exonic
1124129535 15:26971680-26971702 CCGTGCCGCAGCCCAGCCGACGG - Intronic
1126682682 15:51218321-51218343 CCGAGAAGCTGCCCAGCCAAAGG + Intronic
1127790201 15:62391888-62391910 CCGGGACGCCGCCCAGCGCACGG - Intronic
1131514087 15:93065964-93065986 CCGCGCAGCGGCCCAGACGACGG - Intronic
1132546072 16:534082-534104 CCGAGAGGCCCCCCAGCCGTGGG - Intronic
1133010175 16:2906048-2906070 CCCAGCCACCGCCCAGCCCGTGG - Intergenic
1143633722 17:8152608-8152630 CCCAGACACCGCCCAGCCAATGG + Intronic
1143904528 17:10198438-10198460 CGGAGCCGCTGCCCAGCCCGTGG - Exonic
1147684020 17:42276323-42276345 CCGCGCGGCGGCCCGGCCGAGGG - Exonic
1147690854 17:42313524-42313546 CCCATCCCCAGCCCAGCCGAGGG - Exonic
1152257566 17:79249004-79249026 CCGCACCGCATCCCAGCCGATGG - Intronic
1152719122 17:81914244-81914266 CCGAGCCCCTGCCCGCCCGAGGG - Intronic
1156099754 18:33578780-33578802 CCGAGCCGCCGCCCGCTCGCCGG + Intronic
1157544907 18:48540294-48540316 CCGAGCCGGAGCCCACCCCACGG - Intronic
1158505735 18:58044604-58044626 CCGCGCCGCAGCACAGCCGCTGG + Exonic
1161809675 19:6464683-6464705 CCAACCCGCCACCCAGCCCATGG + Exonic
1162378902 19:10320803-10320825 AGAAGCCGCCGCCCAGCTGAGGG - Exonic
1162379040 19:10321222-10321244 CGGAGCTGCCGCCCCGGCGAGGG - Exonic
1163026910 19:14517971-14517993 CCGCGCGGCCGCCAATCCGAGGG + Intronic
1164713386 19:30375100-30375122 CCGAGACGCCGCCCAGCCCCGGG + Intronic
1166827078 19:45616415-45616437 CCGCGCCGCCACCCCGCCCAGGG - Intronic
1167551399 19:50163231-50163253 CCGCCCCGCCTCCCAGGCGAGGG + Intergenic
1168309008 19:55451514-55451536 CCGACCCGCAGCCCAGGCGGCGG + Intergenic
931107007 2:59067199-59067221 CCGAGCCTCCTCCCCGCCGTGGG + Intergenic
938483716 2:131682352-131682374 CTGAGCCTCTGCCCAGCCCAGGG - Intergenic
946622461 2:221573618-221573640 CCCAGCGGCCGCCCGGCCGCCGG - Intronic
949028151 2:241775826-241775848 GCCAGCAGCCGCCCAGCCCAGGG + Intergenic
1175983299 20:62752235-62752257 CCGAGTCCCCGCGCTGCCGATGG + Intronic
1176097836 20:63352427-63352449 CTGAGCGGCAGCCCAGCCGGCGG - Intronic
1176549493 21:8214998-8215020 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1176557388 21:8259227-8259249 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1176568418 21:8398032-8398054 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1176576330 21:8442262-8442284 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1179675110 21:42975320-42975342 CCGCGCCGGCGCCCGGCTGAGGG - Intronic
1181343876 22:22203209-22203231 CCGAGCTGCCGCTAAGCCGCGGG - Intergenic
1182222903 22:28772879-28772901 CCGAGCCGCCGCTCAGAGGGAGG - Exonic
1183710868 22:39502464-39502486 CCTCCCCGCCGCCCAGCCGCCGG - Intronic
1185376864 22:50486664-50486686 CCGAGCCGCTGACCTGCCTAGGG - Intergenic
1203254380 22_KI270733v1_random:131320-131342 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1203262436 22_KI270733v1_random:176399-176421 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
961361547 3:126371197-126371219 CCCAGCCTGCGCCCAGCCCAAGG + Intergenic
971792318 4:31185056-31185078 CCCAGCCTCCGCCCCGCCGTGGG - Intergenic
990308630 5:54517890-54517912 CCGAGCCGAGGCCCACCTGAGGG - Exonic
994083351 5:95731650-95731672 CCGAGTCGCCGCCCTGCCCTTGG + Exonic
996894565 5:128464761-128464783 CCCAGCCTCAGCCCTGCCGACGG - Exonic
1001529812 5:172454136-172454158 CAGCGCCGCCGCAGAGCCGAGGG + Intronic
1002190068 5:177473347-177473369 CCGCCCCGCCGCCCCGCCGCCGG - Intronic
1002718381 5:181243297-181243319 CTGAGCTGCCGCCCGGCCCAAGG - Intronic
1003117820 6:3295085-3295107 CCCAGCAGCAGCCCAGCCGAAGG - Intronic
1005746084 6:28838954-28838976 CCGAGCCTCCGTCCCGCCGGGGG + Intergenic
1006359215 6:33578133-33578155 GCGAGCCACTGCCCAGCCAATGG + Intronic
1006470142 6:34224057-34224079 CCGGCCCGCCGCCCAGCGCAGGG - Intergenic
1006535606 6:34696642-34696664 CCAAGCCGCCGCCGCGCCGCCGG + Exonic
1008545124 6:52577125-52577147 CCCAGCCCCCGCCCAGCCCGCGG + Intergenic
1009431624 6:63572501-63572523 CCGAGCCGGCCCGCAGCCGAAGG - Exonic
1013272470 6:108557747-108557769 CCGAGCCGCGGCGGAGACGACGG - Intergenic
1014272374 6:119349176-119349198 AGGATCCGCAGCCCAGCCGAGGG - Exonic
1015654056 6:135497499-135497521 CCGACACGCCGCCCAGGAGAGGG + Intronic
1016330537 6:142947576-142947598 CCGCGCCGCCGCCCTGCCCGGGG + Intergenic
1019300595 7:301642-301664 CCCTGCCGCCGCCCACCCGAGGG + Intergenic
1020125288 7:5529949-5529971 CCGAGCCGCTGGCCGCCCGAGGG - Intronic
1026949344 7:74337223-74337245 CCAAGCTGCAGCCCAGCCTAAGG - Intronic
1029273855 7:99392895-99392917 CCGAGGCCCCGCCCACCCGCCGG - Intronic
1029640785 7:101817500-101817522 CCGAGTCGCCGCCGTGCCCAAGG + Intronic
1033227926 7:139575483-139575505 CCGACCACCCTCCCAGCCGAGGG - Intronic
1035714959 8:1747014-1747036 CCCAGGGGCCACCCAGCCGAGGG + Intergenic
1037216228 8:16455826-16455848 CCGACCCGCCTCCCAACCCAGGG - Intronic
1037826794 8:22164841-22164863 CCGAGCCCCCGCCCCGCCGCGGG - Exonic
1037865862 8:22441503-22441525 CCGAGCCGCCGCCCAGCCGAAGG - Intronic
1039050061 8:33484790-33484812 CCCAGCCTCCTCCCAGCAGAGGG + Exonic
1040027672 8:42796658-42796680 CCGAGCCGACGCCCACCTGTGGG - Intergenic
1048186857 8:132249745-132249767 CCGAGCCTCCCCCTAGCCGTGGG - Intronic
1049375703 8:142288101-142288123 CCGAGCCCCTGCCCAGCCTGTGG + Intronic
1060583384 9:124771087-124771109 ACGAACCGCCGCCTAGCGGAGGG - Exonic
1061186929 9:129060281-129060303 CAGAGCCGCTCACCAGCCGAGGG + Intronic
1061731010 9:132613980-132614002 CTGAGCCAGAGCCCAGCCGATGG + Intronic
1203470781 Un_GL000220v1:114464-114486 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1203478602 Un_GL000220v1:158436-158458 CCGCGCCCCCGCCCCGGCGACGG + Intergenic
1195031238 X:100929313-100929335 CCGGGCAGGCGGCCAGCCGAGGG + Intronic