ID: 1037865884

View in Genome Browser
Species Human (GRCh38)
Location 8:22441556-22441578
Sequence CACCCTAGGAGGGCTCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037865862_1037865884 30 Left 1037865862 8:22441503-22441525 CCTTCGGCTGGGCGGCGGCTCGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037865884 Original CRISPR CACCCTAGGAGGGCTCGGAG GGG Intronic
904081029 1:27872683-27872705 CACCAAGGGAGTGCTCGGAGGGG - Intronic
904360161 1:29965947-29965969 CTGCCAAGGAGGGCTCAGAGAGG + Intergenic
904847536 1:33431166-33431188 CACCCTAGAAGGGCGGGGATTGG + Intergenic
909814531 1:79975343-79975365 CACAGTAGGAGGGATGGGAGAGG + Intergenic
915007842 1:152656408-152656430 CACCTTAGGAGGGCTCTTAGGGG - Intergenic
915849560 1:159306667-159306689 CAGCTTAGGAGGGCTGGGAAAGG + Intronic
922177577 1:223208644-223208666 AACCCTGGGTGGGCTCGGAGTGG - Intergenic
922933876 1:229409496-229409518 CACCCAGGGACGGCTCAGAGAGG - Intergenic
924668088 1:246094363-246094385 TACCCTAGGAGGGCTCTGATAGG + Intronic
1064027489 10:11860236-11860258 CACCCTAGAGGGGCTCGGGTAGG + Intronic
1070813347 10:79309366-79309388 CACCCTGGGAGAGCAGGGAGGGG - Intronic
1074139700 10:110661168-110661190 TATCCTAGGTGGGCTCAGAGAGG - Intronic
1076595166 10:131620582-131620604 CACCCTCCCAGGGCTCAGAGAGG - Intergenic
1077014290 11:393077-393099 AAGCCTAGGAGGGCTGGGGGTGG - Intronic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1081611971 11:44568300-44568322 CACCATTGGAGGGGTGGGAGGGG + Intronic
1083674130 11:64316118-64316140 CCCCCTAGGAGGGGGAGGAGAGG - Exonic
1084325625 11:68398281-68398303 CACCCTAGCTGTGCTCTGAGGGG - Intronic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1088653288 11:111976980-111977002 CACCAAGGGAGGGCTCAGAGTGG + Intronic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1092491379 12:8949057-8949079 CACCCTGGGAGAGCTTTGAGGGG - Intronic
1109627455 13:64994037-64994059 CTCCCTAAGAGAGCTCTGAGTGG - Intergenic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1122087006 14:99314771-99314793 CATGCTAGGTGGGCTTGGAGAGG - Intergenic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132630307 16:914158-914180 CCTCCTAGGAGGGGTCGGGGTGG - Intronic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG + Intronic
1135712144 16:24726963-24726985 CAGCCCAGGAGGGCTCAGATGGG + Intergenic
1136551112 16:30983102-30983124 CACCCGAGGAGGGCGTGCAGAGG + Intronic
1138598325 16:58041206-58041228 GCCCCGAGGAGGGCTCGGTGTGG - Intronic
1141386539 16:83626838-83626860 CTCCCTAGGACGCCTCGGAATGG + Intronic
1142912286 17:3104575-3104597 TACCCTAGGAAGGCTGGGTGTGG + Intergenic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1144633869 17:16891362-16891384 CACCCAAGGAAGGCACAGAGGGG - Intergenic
1144814654 17:18025531-18025553 CACCCTAGTAGGGCACAGGGAGG + Intronic
1146791010 17:35750483-35750505 CCCCCTAGGAGGGGTCTGGGCGG + Intronic
1147591774 17:41688676-41688698 GACTCTAGGAGAGCTGGGAGGGG - Intergenic
1148475975 17:47928984-47929006 TTCCCTTGGAGAGCTCGGAGAGG + Intergenic
1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG + Intronic
1148641656 17:49192473-49192495 CAAGCTAGGAGGGCTCTGGGCGG - Intergenic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG + Intronic
1152804098 17:82346890-82346912 CTCCCCAGGAGGGCTCCGAGGGG + Intergenic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG + Intronic
1160792049 19:927490-927512 AAACCCAGCAGGGCTCGGAGCGG + Intronic
1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG + Intronic
1163665911 19:18604078-18604100 CACTCTAGAAGGGCTGAGAGGGG - Intronic
1164788581 19:30957293-30957315 CACCCTTGGAGGGCAAAGAGTGG + Intergenic
1165764688 19:38343386-38343408 CAGCCTAGGAGGGGGCAGAGGGG - Intronic
1167272045 19:48511363-48511385 CAGCCCAGCAGGGCCCGGAGCGG - Intronic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
928420506 2:31134695-31134717 CACCCTTGGAGAGCTCCCAGGGG - Intronic
934896516 2:98124455-98124477 GATCCTAGGAGGGATCTGAGAGG + Intronic
934917266 2:98310310-98310332 GACCCCAGGAGGGCATGGAGTGG + Intronic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
1168850547 20:973752-973774 CACTCTATGAGGCCTGGGAGGGG - Intronic
1169353543 20:4889449-4889471 CACCGTAGGAGAACTGGGAGAGG + Intronic
1169913539 20:10666474-10666496 CATCCCAGGAGGGCTTGGAAAGG + Intronic
1172435902 20:34928759-34928781 CCCCTCAGGAGGGCTAGGAGAGG + Exonic
1177519464 21:22200205-22200227 CACACTGGGAGGACTTGGAGAGG - Intergenic
1179407570 21:41138056-41138078 CACCGTTGGAGGGCACTGAGTGG - Intergenic
1181618579 22:24071877-24071899 CACCCAGGGAGGGCAAGGAGTGG - Intronic
954796178 3:53162163-53162185 CACCCTGGGAGGGGTCTCAGAGG - Intronic
961819833 3:129570365-129570387 CACCCCAGGATGGCTCTGACTGG - Intronic
961950713 3:130746675-130746697 CCCTCGAGGAGGGCTCGGACGGG - Exonic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
1001382890 5:171315584-171315606 CTCCCTAGGAGGCCGCGCAGCGG + Intergenic
1002075962 5:176708693-176708715 CACATTTGGAGGGCTGGGAGGGG - Intergenic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1006150193 6:31982953-31982975 CATCCTGAGAGGGCTCGGAGGGG - Intronic
1006156494 6:32015691-32015713 CATCCTGAGAGGGCTCGGAGGGG - Intronic
1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG + Intergenic
1018629464 6:165809746-165809768 CCCACTAGGAGGGCTGGGAAGGG - Intronic
1019504025 7:1381698-1381720 CACCCTTGGGGGGCTGGGAGGGG - Intergenic
1022127887 7:27375593-27375615 GACACTAGGAGGGCTCTGTGGGG - Intergenic
1026936571 7:74259990-74260012 CAGCCTCGGAGGGGTGGGAGTGG + Intergenic
1032511370 7:132475231-132475253 ATCCCAAGGAGGGCTGGGAGGGG - Intronic
1033597943 7:142869997-142870019 CAACCTGGGAGGGATCGGGGTGG - Intronic
1033656823 7:143380820-143380842 CACCCCAGGCGGACTCGGGGTGG + Intergenic
1034539276 7:151745816-151745838 CCCCCATGGAGGGCTCGGTGGGG + Intronic
1035657251 8:1319460-1319482 CACCCTCGGAGAGATTGGAGTGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1040590113 8:48783848-48783870 CACACTAGGACAGCCCGGAGGGG + Intergenic
1041967453 8:63696189-63696211 CACCTTAGGAGGGGTTGGTGGGG + Intergenic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1051513881 9:17907543-17907565 GACCCTGGGAGGATTCGGAGGGG - Intergenic
1052339857 9:27354236-27354258 CACCCTATCAGGCCTCTGAGTGG - Intronic
1058328874 9:103733978-103734000 CACTCTAGGAGAGCTCTGATAGG + Intergenic
1061162491 9:128903199-128903221 GACCCTAGGAGGGCCTGCAGGGG + Intronic
1061429282 9:130520990-130521012 CCCCATGGGAGGGCTGGGAGCGG + Intergenic
1062625118 9:137438987-137439009 CACCCTAGGAGTGCCTGGGGTGG - Intronic
1192523984 X:71825585-71825607 AAACCTAGGAGGGCATGGAGTGG + Intergenic
1198863114 X:141091886-141091908 TACCCTATGAGGGCCGGGAGGGG + Intergenic
1198899576 X:141495501-141495523 TACCCTATGAGGGCCGGGAGGGG - Intergenic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG + Intronic