ID: 1037866753

View in Genome Browser
Species Human (GRCh38)
Location 8:22450247-22450269
Sequence CACTTTCCACATCAACTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037866753_1037866756 26 Left 1037866753 8:22450247-22450269 CCAGACAGTTGATGTGGAAAGTG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1037866756 8:22450296-22450318 AAGAGATTGAAGTGAAAAAAGGG No data
1037866753_1037866757 27 Left 1037866753 8:22450247-22450269 CCAGACAGTTGATGTGGAAAGTG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1037866757 8:22450297-22450319 AGAGATTGAAGTGAAAAAAGGGG No data
1037866753_1037866755 25 Left 1037866753 8:22450247-22450269 CCAGACAGTTGATGTGGAAAGTG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1037866755 8:22450295-22450317 GAAGAGATTGAAGTGAAAAAAGG No data
1037866753_1037866758 30 Left 1037866753 8:22450247-22450269 CCAGACAGTTGATGTGGAAAGTG 0: 1
1: 0
2: 0
3: 14
4: 134
Right 1037866758 8:22450300-22450322 GATTGAAGTGAAAAAAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037866753 Original CRISPR CACTTTCCACATCAACTGTC TGG (reversed) Intronic
900465985 1:2825668-2825690 CCCTCTCCAGATCAACAGTCAGG - Intergenic
900471709 1:2858232-2858254 CAGTTTCCACATCAACCATCAGG + Intergenic
901671195 1:10857193-10857215 CAGTTTCCCCCTCAGCTGTCAGG - Intergenic
902892071 1:19451697-19451719 CACTTTCCACATGGACAGTGTGG + Intronic
903804499 1:25995235-25995257 CACTGTCCACATCCATTATCTGG + Intronic
905994981 1:42373962-42373984 CACTTTCGACACCAAATGTGTGG + Intergenic
907288482 1:53397270-53397292 CAGTTTCCTCATCAAATGTGAGG + Intergenic
907343656 1:53756121-53756143 CACTCACCTCATCAATTGTCTGG + Intergenic
908077031 1:60531360-60531382 CTCTTTCCTTATCAACTGACTGG - Intergenic
911549483 1:99262670-99262692 CACTTTGCACCTCAATGGTCTGG - Intergenic
912283775 1:108346472-108346494 CATTTACCACATCTACTATCTGG - Intergenic
912936818 1:114010883-114010905 CACTTTCCCCATAAGCTGGCGGG + Intergenic
913571213 1:120121904-120121926 CTATTTCCAAATCAACTTTCAGG - Intergenic
914292023 1:146282881-146282903 CTATTTCCAAATCAACTTTCAGG - Intergenic
914553067 1:148733664-148733686 CTATTTCCAAATCAACTTTCAGG - Intergenic
914994640 1:152532308-152532330 AACTTTCCTCATCAATTATCTGG + Intronic
916101028 1:161393365-161393387 CACTTTTGACATCAAATGTGTGG + Intergenic
916210720 1:162357462-162357484 CACTTTCCACCCCAAATATCAGG - Intronic
918332166 1:183471605-183471627 CACTTCCCACAGCAACTGGGGGG - Intergenic
920207213 1:204301275-204301297 CACTTGCCTCATCACCAGTCTGG + Intronic
921042174 1:211443443-211443465 CACTTTTCAAATCTAATGTCTGG + Intergenic
921363095 1:214348368-214348390 CCTTTTCCACATCAACAGTTTGG + Intergenic
922357735 1:224792512-224792534 CATTTTCCATATGAAATGTCAGG + Intergenic
923226348 1:231941987-231942009 CTCTTTCCCCATCCTCTGTCTGG - Intronic
923541854 1:234893817-234893839 CACTTTCCACGTGTACTGTGGGG - Intergenic
924498842 1:244616717-244616739 CACTTTCCATCTCAACTTTTGGG + Intronic
1065766019 10:29030173-29030195 CAATTTCCACATCACCTTTGAGG + Intergenic
1065972009 10:30812974-30812996 CACTTTCCTCATCCAGGGTCGGG - Intergenic
1067698053 10:48549528-48549550 CCCTGTCCACATCAATTATCTGG + Intronic
1072922630 10:99589274-99589296 CCCTTTTCACGTCATCTGTCTGG - Intergenic
1074028724 10:109663619-109663641 CCCTTGCCACATCTGCTGTCTGG + Intergenic
1074031561 10:109694020-109694042 CACTCTCCACATCACCTACCTGG - Intergenic
1075547517 10:123366311-123366333 CACATTCCACATCAGGTTTCTGG - Intergenic
1075989130 10:126818578-126818600 CACTTTCCATAACGACAGTCTGG + Intergenic
1079182970 11:18209854-18209876 CTCTTTCCACAACAGCTGTATGG + Exonic
1079362305 11:19779161-19779183 CACTTTTCAAATTAACTGTGAGG + Intronic
1082278364 11:50245519-50245541 CTCCTTCCACAGCAACTGGCTGG - Intergenic
1085802463 11:79603027-79603049 CTCCTTCCCCATCAAGTGTCAGG - Intergenic
1087891286 11:103541148-103541170 CATCTTTCACATCAAGTGTCAGG + Intergenic
1089786791 11:120913288-120913310 CACCCTCCACATCCTCTGTCTGG - Intronic
1090430218 11:126639718-126639740 CACTTTCCAACTCATCTGTCTGG + Intronic
1093205607 12:16244995-16245017 CACTTTTGACATCAACTGCTAGG - Intronic
1096626929 12:52901643-52901665 CCCTTTCAATCTCAACTGTCTGG - Intronic
1096794779 12:54069506-54069528 CAGTTTCCACATGAACTCTAAGG - Intergenic
1103159478 12:118716443-118716465 CATTTTCCACAGCAACAGCCAGG + Intergenic
1104155390 12:126126349-126126371 CCCTTTCCCCATCAGGTGTCAGG + Intergenic
1104769290 12:131350941-131350963 CACATTCCACATCTTCTTTCTGG - Intergenic
1106248434 13:27967145-27967167 CACTTTCTACAGCCCCTGTCTGG - Intronic
1107373452 13:39777050-39777072 CACTTGCTACATCAAGTGTTAGG + Intronic
1107825562 13:44325998-44326020 CTCTTTCCACATCAAGTGGATGG + Intergenic
1108120039 13:47175638-47175660 CACTTACCACTTCCTCTGTCTGG - Intergenic
1108303301 13:49103706-49103728 CAATTTCCACATCATCTATTTGG - Intronic
1110172703 13:72521622-72521644 GCCTTTGCCCATCAACTGTCTGG - Intergenic
1110438738 13:75504431-75504453 CACTTTCCTCATCAAATCTATGG + Intergenic
1111066775 13:83104468-83104490 GACTTTCCACATCAATTGAATGG - Intergenic
1111865685 13:93765246-93765268 AACTTTCCAGATAAGCTGTCTGG + Intronic
1111865687 13:93765275-93765297 AACTTTCCAGATAAGCTGTCTGG + Intronic
1112484058 13:99803780-99803802 TCCTTTGCACATGAACTGTCAGG + Intronic
1112557444 13:100481591-100481613 CAGTTACCAGATCTACTGTCAGG - Intronic
1119901166 14:78261089-78261111 CAAATTCCACATCCACTGCCTGG - Intronic
1121522467 14:94595499-94595521 CTGTTCCCACATCCACTGTCTGG + Intronic
1123167870 14:106343844-106343866 CACTGTGCACAGCCACTGTCTGG - Intergenic
1123170502 14:106368557-106368579 CACTGTGCACAGCCACTGTCTGG - Intergenic
1124903471 15:33846135-33846157 GCCTTTCCACATGATCTGTCCGG + Intronic
1126097051 15:45097331-45097353 CACTTTCCACATCTACTTCCTGG - Exonic
1126465994 15:48962456-48962478 CACTTTCTACAGCACCTGTTGGG - Exonic
1126680510 15:51197559-51197581 TACTTCCCACAGCCACTGTCAGG - Intergenic
1132223682 15:100124384-100124406 TACTTTCCTCATCAACAGTGAGG - Intronic
1132609990 16:810834-810856 CCCCGTCCACATCAAGTGTCCGG - Intronic
1132925421 16:2426852-2426874 AACTTCCCACATCAACAGACAGG + Intergenic
1135591319 16:23706857-23706879 CACTTTCCACCTCCACAGGCCGG - Exonic
1136334604 16:29603208-29603230 CACTTGCCCCCTCACCTGTCAGG + Intergenic
1139566676 16:67781926-67781948 CACTATCCACTGCAACTGGCAGG + Intronic
1140406704 16:74716346-74716368 CACTTTGCACATCAGAAGTCAGG - Exonic
1142737508 17:1910591-1910613 CTCTTTCTACATCAACTCTTTGG + Intergenic
1146230211 17:31100928-31100950 CACTTTCCACCTTATCTGTCTGG + Intronic
1147760607 17:42795358-42795380 CACTCTCCACCTCAGCTGTGTGG - Exonic
1149331512 17:55587606-55587628 CATTTTCCACATAAACACTCAGG + Intergenic
1151453165 17:74211659-74211681 CACTTTCCCCAGCAACTGCAGGG + Intergenic
1156029509 18:32695851-32695873 CACTATCCACATCATCAGGCAGG - Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160449754 18:78954446-78954468 CAGTTTCGACATCAACTGTTTGG - Intergenic
1162045943 19:8000532-8000554 CACTTCACACATCATCTGACAGG + Intronic
926310686 2:11673815-11673837 CAGTTTCCACATCAAGTTTAAGG + Intergenic
928214531 2:29350348-29350370 CACTGGCCACAACAAATGTCTGG - Intronic
928216959 2:29369778-29369800 CATTTTCCATCTCAACTGTTTGG - Intronic
929947526 2:46381997-46382019 CCGTTTCCACATCAAATGTGAGG - Exonic
930050182 2:47209287-47209309 CAGTTTAGGCATCAACTGTCTGG + Intergenic
931509856 2:62979509-62979531 TGCTTTCCACATCAACTTTTTGG + Intronic
931686138 2:64795797-64795819 GATTTTCCACATTAACTTTCTGG - Intergenic
932489485 2:72111320-72111342 GACTTCCCACAACAACTGCCTGG - Intergenic
932640999 2:73446640-73446662 CTCTTTCCACTACAACTGACTGG - Intronic
933657613 2:84902706-84902728 CTCTTTCCCCATCCACTGGCTGG + Intronic
935560673 2:104556128-104556150 CGCTTTCATCATCAACTGGCAGG + Intergenic
937492799 2:122387497-122387519 CAGCTTCCCCTTCAACTGTCTGG - Intergenic
940104975 2:150089221-150089243 CACTTTCCTCAGCAGTTGTCGGG + Intergenic
945367497 2:208974072-208974094 CACTTTCCACATTAACTTCTGGG - Intergenic
946507538 2:220317672-220317694 CAGGTTCCACACCAACGGTCAGG + Intergenic
946710894 2:222504151-222504173 CACTTTCCACACCAGCGGTGGGG + Intronic
1169180025 20:3555758-3555780 CACTTTGCAAATAAAATGTCTGG + Intronic
1170337706 20:15288980-15289002 CAATATCCACATCAAGGGTCTGG + Intronic
1172744771 20:37198131-37198153 CACTTCCCGGATCACCTGTCTGG - Intronic
1173817253 20:45997768-45997790 CAATTTCCAAATCACCTGTATGG - Intergenic
949886960 3:8703093-8703115 CACTTTCCACAGCCACTGCTTGG - Intronic
953337058 3:42102369-42102391 TGCCTTCCACATCAACTGTTTGG - Intronic
955896677 3:63707748-63707770 CATTTTCCAAGTGAACTGTCAGG - Intergenic
960403188 3:117228932-117228954 TCCTTTCCACATCTTCTGTCTGG - Intergenic
960547689 3:118935204-118935226 CAATTTCCACATGAAATATCAGG + Intronic
963518778 3:146339047-146339069 CATTTTCCAAATCGACTTTCTGG - Intergenic
965387349 3:168060607-168060629 CACATTCCCTATCCACTGTCTGG - Intronic
965430341 3:168579165-168579187 CACTTTCCTAATCAGCTGTCAGG - Intergenic
970680602 4:18503165-18503187 CACTTTCCACAGAAGCAGTCTGG - Intergenic
972337109 4:38116995-38117017 CACTTTCCACATGTACTGTGAGG + Intronic
974250910 4:59381714-59381736 TACTTTCTTCATCAAATGTCTGG + Intergenic
975357556 4:73425722-73425744 TAGATTCCACATCAATTGTCAGG + Intergenic
978379134 4:108108221-108108243 GACTTTCCACATCAACCTTCAGG + Intronic
982216743 4:153088819-153088841 AGCTTTCCACATCAACTCACAGG - Intergenic
982727239 4:158918714-158918736 TACTGGCCACATCAACTGTGGGG + Intronic
983784193 4:171711793-171711815 CACTTTCCAAATCATTTGACAGG - Intergenic
990846265 5:60143266-60143288 CATGTTGCACATAAACTGTCTGG - Intronic
991292540 5:65046581-65046603 CTCTATCCACATTTACTGTCTGG + Intergenic
992996100 5:82335183-82335205 GACTTTCCACATCACCTATAAGG + Intronic
995098285 5:108266477-108266499 CAGTTATCAAATCAACTGTCAGG + Intronic
1000260602 5:159584915-159584937 CCCTTTCCACATCAAGTTTCAGG - Intergenic
1004527768 6:16425368-16425390 CATTTTACGCATTAACTGTCTGG + Intronic
1010748031 6:79586657-79586679 CTCTTTCCACATGAACAGCCTGG + Intergenic
1032160098 7:129503072-129503094 TATTTTCCACATCAACCGTCTGG - Intronic
1033486492 7:141794477-141794499 CATTTTCCACATCACCTTTTGGG + Intergenic
1034194922 7:149239252-149239274 CAGTTTCCATATCAACAGTGTGG - Intergenic
1035167084 7:156997781-156997803 CTCTCTCCACATCAGCAGTCAGG + Intronic
1037866753 8:22450247-22450269 CACTTTCCACATCAACTGTCTGG - Intronic
1038169900 8:25121455-25121477 AACTTTCCACATCAATTGCCTGG - Intergenic
1039365353 8:36922975-36922997 CAATTTCCACATGAGCTGTTTGG - Intronic
1041541327 8:58988417-58988439 TATTTGCCACATCAACTATCTGG + Intronic
1042374302 8:68031665-68031687 CTCTTTCCATTTCAAGTGTCCGG + Intronic
1042463010 8:69092825-69092847 CACTTTCCACACCAAAGGTATGG - Intergenic
1043886073 8:85602299-85602321 CACTTTGCACCTCAAGTGTCTGG + Intergenic
1044627970 8:94253071-94253093 CACTTTCCCCATCAACCATCAGG + Exonic
1047082337 8:121476976-121476998 CCATTTTCACATCAACTGTGGGG + Intergenic
1050614491 9:7387976-7387998 CATTTTCCACAGCATGTGTCTGG + Intergenic
1057396288 9:94683344-94683366 CACCTTCCAGAACAACTGTGAGG + Intergenic
1060733793 9:126053620-126053642 CATTTTCCAGACCCACTGTCCGG - Intergenic
1061024805 9:128041582-128041604 CACTTTGCACACCATCTATCTGG - Intergenic
1061645626 9:131998744-131998766 GACTTTACACATCAAATGTGGGG - Intronic
1186682451 X:11890242-11890264 CACTTTGCACAGCAAGAGTCTGG - Intergenic
1197509761 X:127356238-127356260 CACTTTCCCCAACAGCAGTCGGG + Intergenic
1197514338 X:127406223-127406245 CACTTTCCAAAACATCTTTCAGG + Intergenic
1199522090 X:148747556-148747578 CACTTTCCAAATAATCTGCCTGG + Intronic
1200755893 Y:6989632-6989654 CACTGTCCACATCATATGTTAGG - Intronic