ID: 1037873029

View in Genome Browser
Species Human (GRCh38)
Location 8:22517603-22517625
Sequence CAGAAGAAATGGATAGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 8, 3: 57, 4: 392}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037873029_1037873033 -5 Left 1037873029 8:22517603-22517625 CCAGACTCTATCCATTTCTTCTG 0: 1
1: 0
2: 8
3: 57
4: 392
Right 1037873033 8:22517621-22517643 TTCTGGGTTTTCCAGTGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037873029 Original CRISPR CAGAAGAAATGGATAGAGTC TGG (reversed) Intronic
901078197 1:6568793-6568815 CAGAAGAGAAGGAAAGAGTGTGG - Intronic
901949734 1:12733361-12733383 TAGAAGAAAAGGATAAATTCTGG - Intergenic
902441881 1:16435779-16435801 CAGTATAAATGGACAGAGGCAGG - Intronic
903163773 1:21507276-21507298 CAGAAGTCAGGGATAGGGTCGGG + Intergenic
903311715 1:22463860-22463882 CATTAGAAATGGAGAGAATCTGG + Intronic
904150903 1:28439704-28439726 CAGAAGAGAAGGATAGTGTGAGG - Intronic
905298749 1:36971813-36971835 CAGAAGAAAAGGAAGGTGTCAGG - Intronic
905744341 1:40401320-40401342 AGGTAGAAATGGATAGATTCTGG + Intronic
906381963 1:45338367-45338389 CAGAGGAAATGGATTGTGTGAGG - Intronic
906500821 1:46340908-46340930 AAGAAGAAATGGGTAAGGTCCGG + Exonic
906558186 1:46731905-46731927 TAGAAGAAATGGATAAATCCTGG + Intergenic
907423534 1:54363753-54363775 CAGAAGAAATGTATAGGGAAAGG + Intronic
907829356 1:58049472-58049494 CAGAAGGAATTGATTGTGTCTGG + Intronic
908921763 1:69202817-69202839 AAGAAGAAAAGGATAAAGCCAGG + Intergenic
909016438 1:70385079-70385101 AAGAAGAATGGGACAGAGTCAGG - Intronic
909053770 1:70798689-70798711 TAGAAGAAATGGATAAAGTCTGG - Intergenic
909512857 1:76474596-76474618 CAGAAGCAAAGGATGGAGTCAGG + Intronic
911054833 1:93700749-93700771 GAGAACAAATGGACACAGTCGGG + Intronic
911419444 1:97621354-97621376 AAGAAGAAAAGGATAGAGAGAGG + Intronic
912080317 1:105928324-105928346 CATAATAAAGGCATAGAGTCGGG + Intergenic
913346067 1:117812266-117812288 AAGAAGAAATGGGCAGAATCTGG + Intergenic
915366739 1:155321062-155321084 CAGGAGAAATGAATAGAGAAAGG + Intronic
915893769 1:159795127-159795149 CAGAAAAGATGGAGAGAGTAAGG + Intergenic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
917568681 1:176239209-176239231 AGGAAGAAATTGAAAGAGTCGGG - Intergenic
918661066 1:187089717-187089739 CAGAAGCAATGAACAGAGTTCGG + Intergenic
918822829 1:189279809-189279831 CAGAAGGAATGGATAAACTTTGG - Intergenic
919007835 1:191922332-191922354 CAGAAGAAATGGAAATAGACAGG + Intergenic
919745773 1:201008388-201008410 CAGAAGGAAGGGAGAGAGCCAGG + Intronic
920410478 1:205755948-205755970 CAGAGGACAGGAATAGAGTCAGG - Intergenic
920505961 1:206515576-206515598 AAGAAGACATGGATAGGGACTGG + Intronic
921514121 1:216068633-216068655 CTGAAGAAACAGAAAGAGTCAGG + Intronic
922429748 1:225539214-225539236 CAGTAGCAATGGAGAGAGTTTGG - Intronic
923304182 1:232673119-232673141 TAGAAGATATAGCTAGAGTCAGG - Intergenic
1063775324 10:9256814-9256836 CAGAGGAAATTGATGGAGTACGG + Intergenic
1063780695 10:9319740-9319762 CAGAAGAAATGCAGAAATTCAGG + Intergenic
1066588102 10:36960596-36960618 TAGAAGAGATGCATAGAGTAAGG + Intergenic
1066751554 10:38662571-38662593 TGGAAGAAATGGATAAATTCTGG + Intergenic
1066965482 10:42260523-42260545 TAGAAGAAATGGATAAATTCTGG - Intergenic
1068441649 10:57063275-57063297 AAGAAAAAATGGATAGAATTAGG - Intergenic
1068801496 10:61145615-61145637 CAGAAGAAAAAGACAGAGTATGG - Intergenic
1069017134 10:63443186-63443208 CAGAAGAAATGCATGGGGTGAGG + Intronic
1069349827 10:67511939-67511961 TAGAAGAAATGGATAAATTCCGG - Intronic
1069941788 10:71961715-71961737 CAGAAGAGAAGGAAAGAGTGTGG - Intergenic
1071319908 10:84444178-84444200 CAGAAGACATAGATAGATTTAGG + Intronic
1071772667 10:88747012-88747034 TAGAAGAAATGCATAAATTCCGG + Intronic
1072979703 10:100089642-100089664 CAAGAAAAATGGACAGAGTCAGG - Intergenic
1073472349 10:103730831-103730853 GAGGAGAAATGCACAGAGTCGGG + Intronic
1075365931 10:121888745-121888767 CAGTAGAAAGGGATAAATTCTGG + Intronic
1076376369 10:129989819-129989841 CAGAGGAAATGGTGGGAGTCAGG + Intergenic
1077339775 11:2021139-2021161 CAGAAGCAATTGGAAGAGTCTGG + Intergenic
1077526681 11:3070176-3070198 CTGAAGAACTGAATAGATTCTGG - Intergenic
1077705163 11:4478276-4478298 CAGCAGAAATGAACAGAGTTAGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079725311 11:23873306-23873328 CAGAAGCCATGGATACAGTGAGG + Intergenic
1080153963 11:29086223-29086245 CACAATAAATGGTTAAAGTCAGG + Intergenic
1080563157 11:33483115-33483137 CAGAAGGAAAGGATAGAGGAAGG - Intergenic
1080709177 11:34730288-34730310 CAGAAGAAATGGAAACATTCTGG + Intergenic
1081948685 11:47022690-47022712 CAGAGGATATGGATAGTGTATGG - Intronic
1081996159 11:47365554-47365576 CAGCAGATATTGATAGAATCAGG + Intronic
1082207235 11:49452408-49452430 CAGAAGAAAAGGAAGCAGTCTGG - Intergenic
1082279690 11:50258388-50258410 GAGAAGAAATGGAGACAGACAGG - Intergenic
1083466251 11:62848440-62848462 CAGAAGAAATGTGAAGAGCCAGG + Intergenic
1084376303 11:68780374-68780396 CAGAAGAAATCGATTGAACCCGG - Intronic
1086648041 11:89249325-89249347 CAGAAGAAAAGGAAGCAGTCTGG + Intronic
1086825091 11:91486491-91486513 TAGAAGAAATGGATAAATTCTGG - Intergenic
1087784299 11:102337780-102337802 AAGAAGGTATGGAAAGAGTCTGG - Intronic
1087934811 11:104020349-104020371 AAGATTAAATGGATAGAATCAGG - Intronic
1087969956 11:104468216-104468238 CTGAAAAAATGGTTAGAGTTTGG - Intergenic
1088016527 11:105067516-105067538 CAGAACATAAGGATAGAGTGGGG - Intronic
1088549315 11:110995218-110995240 CAGTATAAAAGGATAGACTCAGG - Intergenic
1090433905 11:126669994-126670016 GAGAAGGAATGGGAAGAGTCAGG - Intronic
1090881311 11:130833547-130833569 CCAAAGACATGGACAGAGTCTGG + Intergenic
1091133841 11:133170171-133170193 CAGAATAAAAGGATATAGCCAGG + Intronic
1091260453 11:134229939-134229961 CAGAAGAAAAGGATAGTTTGTGG - Intronic
1202822760 11_KI270721v1_random:76328-76350 CAGAAGCAATTGGAAGAGTCTGG + Intergenic
1091860406 12:3776448-3776470 GAGGAGAAGTGGATGGAGTCAGG + Intergenic
1092228613 12:6764827-6764849 CAGAAAAGATGGACAGAGTCCGG + Intronic
1092404737 12:8211683-8211705 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1093361733 12:18237596-18237618 TAAAAGAAATGGATAAATTCCGG - Intronic
1093883631 12:24434702-24434724 CAGAAGGAAGGGAGAGAGTGAGG - Intergenic
1097882373 12:64698077-64698099 CAGATGGGATGGATAGTGTCTGG + Intergenic
1097906715 12:64927421-64927443 CAGAGGAAATGGATAAATCCTGG - Intergenic
1098465441 12:70781734-70781756 CAGAACAAAAGGATAAAGACAGG + Intronic
1098794135 12:74866840-74866862 TAGTAGATATTGATAGAGTCCGG - Intergenic
1099235804 12:80081035-80081057 TAGAAGAAATGGATAAATTTTGG - Intergenic
1099472775 12:83071748-83071770 TAGAAGAGATGGATAAATTCCGG - Intronic
1099652675 12:85448211-85448233 GAGAAGAAGTGGTTAGATTCTGG + Intergenic
1102559055 12:113749195-113749217 CAGGAGAGATGGAAAGAGGCAGG + Intergenic
1102664616 12:114560650-114560672 TAGAAGAAATGAATATTGTCTGG - Intergenic
1102940478 12:116937055-116937077 CAGCAGAAGTGGACAGAGTCAGG + Intronic
1103859333 12:123999722-123999744 AGGAAGAAAGGGCTAGAGTCGGG + Intronic
1104086580 12:125480506-125480528 TAGAAGAAATGGATAAATTCCGG + Intronic
1104836526 12:131795599-131795621 CACAAGAAATGCATGAAGTCCGG + Intronic
1105594749 13:21826964-21826986 CATGAGAAATGGATAGAATTTGG + Intergenic
1105791574 13:23805445-23805467 CAAAGGAATTAGATAGAGTCTGG + Intronic
1105959051 13:25312213-25312235 CAGAAGAAAGGAATAGAGAATGG + Intronic
1106298998 13:28445562-28445584 CAGATGAAATGGATAAATGCCGG + Intronic
1106723423 13:32459524-32459546 CATAAGAAATGGATAAATTCTGG + Intronic
1108554504 13:51579925-51579947 CAGAAGAAAGGCAGAGAGTATGG + Intergenic
1109581340 13:64340771-64340793 CAGAATAAAAGAATATAGTCAGG + Intergenic
1109661385 13:65465061-65465083 TAGAAGAAATGGGTAAATTCCGG - Intergenic
1110045465 13:70823188-70823210 AAGAAGAAATTAATAAAGTCAGG - Intergenic
1110288732 13:73779516-73779538 TGGAAGAAATGGATAGGGTAAGG - Intronic
1112588696 13:100743993-100744015 AAGAAGAATTGGACAGATTCGGG + Intergenic
1113049494 13:106193804-106193826 TAGAAGAAATGGATAAATTTTGG + Intergenic
1113142219 13:107166747-107166769 AAGAAGGGAGGGATAGAGTCGGG - Exonic
1113958149 13:114110422-114110444 AAGGTGAAATGGATACAGTCCGG + Intronic
1114409320 14:22485996-22486018 CAGAGGAAATGGAGAGAGATGGG + Intergenic
1114976501 14:28107162-28107184 CAGCAGAAATGGAATAAGTCTGG - Intergenic
1115690654 14:35840613-35840635 TAGAAGAAATGGATAAATTCCGG - Intronic
1117269261 14:54125008-54125030 CACAAAAAAGGGATAGAATCAGG - Intergenic
1117623385 14:57610724-57610746 GAGAAGAAAGGGAGTGAGTCTGG + Intronic
1118393645 14:65317358-65317380 ATGAAGAAATGGATAGAGAATGG + Intergenic
1118449271 14:65883808-65883830 TAGCAGAAATGGATAAATTCTGG - Intergenic
1119754237 14:77103419-77103441 AAGAACAACAGGATAGAGTCAGG + Intronic
1121357657 14:93229580-93229602 AAGAAAAAATGCATAGAGCCGGG + Intergenic
1122506564 14:102235406-102235428 CGGAAGAAAAGGAAAGAGTGTGG + Intronic
1123108891 14:105856094-105856116 CAGGAGAAAGTGATGGAGTCGGG + Intergenic
1125367445 15:38932931-38932953 CAGAAGAAAGGTATTGAGACAGG - Intergenic
1125392760 15:39212761-39212783 CAGGAGAAATCGCTTGAGTCCGG + Intergenic
1125901668 15:43353832-43353854 ATGAAGAAATGGATAGAGCAAGG - Exonic
1125985047 15:44042179-44042201 TAGAAGAAATGGATAAATTCCGG + Intronic
1127601937 15:60546485-60546507 CAGGAGAAACAGATAGAGACAGG + Intronic
1128854672 15:70999498-70999520 CAGAACCAATCGATAGAGTCTGG - Intronic
1129508208 15:76100625-76100647 GAAATGAAATGGATACAGTCTGG - Intronic
1129737640 15:77974982-77975004 CAGAAGCAATGGAGGGAGGCAGG - Intergenic
1131085784 15:89574873-89574895 CAGAAAAAATGGAAACAGTTTGG - Intergenic
1131319480 15:91372926-91372948 TAGAAGAAATTGATAAATTCTGG + Intergenic
1131903028 15:97109759-97109781 TAGAAGAAATGGATAAATTCTGG + Intergenic
1132378552 15:101349099-101349121 CAGAAGCACAGGGTAGAGTCAGG + Intronic
1133474074 16:6102902-6102924 TAGAAGAAAGTGATGGAGTCTGG + Intronic
1135490954 16:22908980-22909002 CAGAAGAAAGGGGAAGAGCCAGG + Intronic
1137290970 16:47051712-47051734 AAAAAAAAAAGGATAGAGTCGGG - Intergenic
1137352745 16:47727925-47727947 GAGAAGAAGTGGATGGAATCTGG + Intergenic
1137387221 16:48052863-48052885 CAGAAGAATAGGTGAGAGTCTGG + Intergenic
1137820353 16:51438736-51438758 CAGAAGAAAAGCTTATAGTCTGG - Intergenic
1137820815 16:51444077-51444099 CAGAAAAGATGAATACAGTCAGG - Intergenic
1138699132 16:58845307-58845329 CAGAAGAAATGGGTAAAATAAGG - Intergenic
1139187965 16:64829810-64829832 CAGAAGTAGTGGATAAAGTGGGG - Intergenic
1139678323 16:68540128-68540150 AATAAGAAATGGAGAGAGTGGGG + Intronic
1140064253 16:71596819-71596841 TAGAAGAGATGGATAAATTCCGG + Intergenic
1142161944 16:88562185-88562207 CTGAAGACATGGATACAGGCTGG + Intergenic
1143513305 17:7407356-7407378 CGGAGGAAATGGAGAGAGTCTGG + Intronic
1143720142 17:8803558-8803580 CAGAAGAAAGAGGAAGAGTCAGG + Intronic
1144130686 17:12243637-12243659 CAGAAGAAATGGAGTGAGGGTGG + Intergenic
1144398986 17:14876121-14876143 CTGAAGAAATGGATACTGTTTGG - Intergenic
1146072569 17:29697400-29697422 TACAAGAAGTGGATAGAGGCAGG + Intronic
1146595416 17:34164047-34164069 GCGAAGAGATGGATAGAGACGGG - Intronic
1146821294 17:35985207-35985229 CAGAAAAAATGGGTTGAGTAGGG - Intronic
1146986197 17:37220915-37220937 AAGAAGAAATGGAGAGGGGCAGG + Intronic
1147516995 17:41128246-41128268 TAGAAGAGATGGATAAATTCAGG + Intergenic
1148572937 17:48684996-48685018 CAGCAGGTATGGATAGAGGCTGG + Intergenic
1149358453 17:55868748-55868770 CAGAAGAAAGAGAGAGAGTAGGG + Intergenic
1149365764 17:55942356-55942378 TAGAAGAAATGGATCAATTCTGG + Intergenic
1149373105 17:56015506-56015528 TATAATAAATGTATAGAGTCAGG - Intergenic
1149395619 17:56239243-56239265 CATAAGAAATGGAGAGAGGTTGG + Intronic
1153600341 18:6774877-6774899 CAGAAGAAATGGACAGATGCAGG - Intronic
1154093301 18:11385324-11385346 CAGAAGAAAGGCATAGTGACTGG - Intergenic
1155012307 18:21792089-21792111 CAGAAGCAAGGGATACAGACAGG - Intronic
1155171159 18:23267654-23267676 CAGAGGAACGGGACAGAGTCAGG - Intronic
1155385240 18:25270180-25270202 TAGAAGAAATGGATAAATTCCGG + Intronic
1155547374 18:26929451-26929473 GAGAAGAAAGGCATAGAGACAGG - Intronic
1155712094 18:28894587-28894609 TAGAAGAAATAAATAAAGTCTGG + Intergenic
1156163031 18:34383219-34383241 CAGAAGAGATTGATGGAGGCAGG - Intergenic
1156755567 18:40520406-40520428 CAGAATAAATGGAAAATGTCTGG - Intergenic
1158038276 18:53061477-53061499 CAGAAAGGATGGATAGATTCAGG + Intronic
1158085337 18:53644365-53644387 CAGGACAAATGGATAGTGACTGG + Intergenic
1159039674 18:63312045-63312067 TAGAGGAAAAGGATAGTGTCTGG + Intronic
1160702139 19:512781-512803 CAGAAGCAACGGACAGAGTGTGG + Intronic
1161058003 19:2200275-2200297 CAGAAGGGATGGATGGAGACAGG - Intronic
1161385658 19:3991200-3991222 TAAAAGAAATCGATAGAGGCAGG - Intergenic
1163553929 19:17982221-17982243 CAGAAGCAATGGCCAGGGTCGGG - Intronic
1164329316 19:24237177-24237199 AAGAACACATGGATAGAGTAAGG + Intergenic
1164486626 19:28661985-28662007 TACAGGAAATGGATAGATTCTGG + Intergenic
1165648439 19:37465710-37465732 CAGAATAATTGGATAGGTTCTGG + Intronic
1166818248 19:45560173-45560195 CAGATGAAAGGGAGTGAGTCTGG - Intronic
1167654918 19:50757343-50757365 CAGAAGGACTGGATGAAGTCAGG - Intergenic
1167874722 19:52402256-52402278 CAGCAGACATGGATGGAGACGGG + Intronic
926402641 2:12513814-12513836 CAGGAGATATGGAGACAGTCAGG - Intergenic
928381466 2:30822083-30822105 CAGAAGAGCTGGATAGAGGGAGG + Intergenic
930017437 2:46980667-46980689 CAGGGGAAATGGAAGGAGTCTGG + Intronic
930351537 2:50262270-50262292 CAGAAGAATTGAATAGTGTATGG + Intronic
931312443 2:61095088-61095110 CAGTAGCAATTGATATAGTCAGG + Intronic
932080919 2:68714469-68714491 CAGAAGAAAGAGATAGATACAGG - Intronic
932280402 2:70486434-70486456 CACAAGAAATGAATAAAGGCAGG - Intronic
932479422 2:72029908-72029930 CAGGAGAAATGGAAAGAAACAGG + Intergenic
932823634 2:74921559-74921581 CAGAGGAAAAGGAAAGAGTCTGG - Intergenic
934314540 2:91904725-91904747 TAGAAGAAATGTATAAATTCTGG + Intergenic
935177490 2:100662556-100662578 CAGAACAAATTAATAAAGTCAGG + Intergenic
936274274 2:111079966-111079988 TAGAAGAAATGGATAAATTCTGG - Intronic
936764296 2:115827024-115827046 CAGAAGAAATGGAAAGTGTATGG - Intronic
937136787 2:119560232-119560254 CAGAGGACCTGGACAGAGTCAGG + Intronic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
939521648 2:143238978-143239000 GAGAACACATGGATAGAGTGTGG + Intronic
939749018 2:146017708-146017730 GACAGGAAATTGATAGAGTCAGG + Intergenic
939847385 2:147264459-147264481 TAGAGGAAATGGATAAATTCTGG - Intergenic
939904981 2:147901750-147901772 CAGAAGGAAAGCATAAAGTCAGG - Intronic
940925480 2:159359353-159359375 TGGAAGAAATGGATAAATTCCGG + Intronic
941542101 2:166799633-166799655 CAGAAGACATGTTTAGATTCTGG + Intergenic
941629672 2:167869962-167869984 CAGAAGAAATGCACAGAATCTGG + Exonic
941644346 2:168024161-168024183 GAGAAGAAATGGATGGACTGTGG + Intronic
941855837 2:170229956-170229978 CAGTAGAAAGGGATATAGTTGGG + Intronic
942744394 2:179215387-179215409 TAGAAGAAATGAATAAATTCCGG + Intronic
944198608 2:197081671-197081693 CAGAAGAACTTGAAAGAGCCAGG - Intronic
944471596 2:200059045-200059067 CAGAAGAAATGGATAAATTCTGG + Intergenic
944950421 2:204742443-204742465 GAGGAGAAAGGGATAGAGTAAGG + Intronic
944972511 2:205010138-205010160 GAGAAGGAGTGGAGAGAGTCGGG + Intronic
945199959 2:207271776-207271798 CAGGAGAGAGGGATAGAGTAGGG + Intergenic
946040293 2:216777100-216777122 CAAAAGAACTGGATGGAGTCTGG + Intergenic
947175236 2:227359683-227359705 AGGGAGAAATGGATACAGTCAGG + Intergenic
947691389 2:232139864-232139886 CAAAAGAAATGAAAAGATTCAGG + Intronic
948057488 2:235019363-235019385 CAGAAGAAAGGGAGAGATGCAGG + Intronic
948741549 2:240050416-240050438 CAGAAGAAATGGACAGGGGCCGG + Intergenic
1169606182 20:7322080-7322102 TAGAAGAAATGGATAAACCCGGG + Intergenic
1169940367 20:10930721-10930743 TAGAAGAAATGAATACATTCCGG + Intergenic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1173074100 20:39800291-39800313 CAGAAGCAAAGGATAGTCTCAGG - Intergenic
1174180648 20:48672336-48672358 CAGGAGAAATGGTCAGATTCTGG - Intronic
1174513398 20:51072994-51073016 CAGGAGAAATGGAGAGAGCCAGG - Intergenic
1176925976 21:14749163-14749185 GAGAAGAAAGGGATAAAGTGAGG + Intergenic
1178195903 21:30344786-30344808 CTGAAGAAAGGGAGAGAGACAGG - Intergenic
1179389722 21:40976686-40976708 CAGTAGATAAGGATAGGGTCTGG - Intergenic
1180541309 22:16450608-16450630 TAGAAGAAATGGATAAATTCTGG + Intergenic
1181089924 22:20465551-20465573 CAGCAGAAATGGATAATTTCTGG + Exonic
1181799888 22:25339079-25339101 CAGAAGAAATGAACAAATTCAGG - Intergenic
1182049842 22:27304284-27304306 CAGAAAAAATGAATAAAGGCAGG + Intergenic
1183162455 22:36123965-36123987 CAGAAGAAGTGAATAGGTTCAGG - Intergenic
1183501336 22:38181440-38181462 GAGAAGAGATGGATTGACTCGGG + Intronic
1184485353 22:44775281-44775303 CAGCAGAGATGGCGAGAGTCTGG + Intronic
1184692411 22:46123268-46123290 CAGATGAAATGGCAAGAGACAGG + Intergenic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950136623 3:10585553-10585575 CTGCAGAGATGGGTAGAGTCGGG - Intronic
950257490 3:11517772-11517794 CAGCAGAGCTGGAGAGAGTCGGG + Intronic
951241569 3:20291939-20291961 TAGAAGAAATGGATAACTTCTGG - Intergenic
951412011 3:22377224-22377246 CAGAAAGAAAGGTTAGAGTCAGG - Intergenic
951832503 3:26946251-26946273 TAGAAGAACTGGATAAATTCCGG + Intergenic
952165633 3:30745900-30745922 AAGAAGAAATGGAAAGAATAAGG - Intronic
952178243 3:30890655-30890677 CAGACCAAATGTATAGAGTGTGG + Intronic
952440893 3:33327705-33327727 TAGAAGAAATGGATAAATTTTGG + Intronic
952480486 3:33755871-33755893 AAGAATAAATTGATAGAGGCTGG + Intergenic
952655244 3:35778269-35778291 CAGGAGAGATGGATAGAGAATGG - Intronic
952740949 3:36733770-36733792 CAGTAGAAATAGATAAACTCAGG + Intronic
953540596 3:43814396-43814418 CAGACGAAATTGGGAGAGTCTGG + Intergenic
953553763 3:43925557-43925579 CAGAAGAGAAGGACAGAATCTGG - Intergenic
954350149 3:50036498-50036520 CAGCAGATATGTATAGAGTGAGG - Intronic
955361364 3:58278344-58278366 TAGAAGAAATGGATAAATCCTGG - Intronic
955445419 3:59004984-59005006 CAAAAGGTATGGATAGAGTAAGG - Intronic
955586441 3:60483076-60483098 TAGAAGAAATGGATAAATTCTGG + Intronic
955976394 3:64484504-64484526 CAGAAGAAAAGGATTCACTCCGG - Intergenic
957166698 3:76682912-76682934 CAGAAGAAAGGGCTAGATTGAGG + Intronic
957314565 3:78560759-78560781 CAGAAGGCAAAGATAGAGTCAGG + Intergenic
957587027 3:82146001-82146023 CAGAAGAGAAGGATAGAGAAAGG + Intergenic
958422578 3:93945064-93945086 TAGAAGAAATGGATAAATTCTGG + Intronic
958649863 3:96925388-96925410 TAGAAGAAATGGATAAATTCTGG - Intronic
958795912 3:98706054-98706076 CAGAAAAAATGTATAGAATGAGG + Intergenic
959278495 3:104307699-104307721 TAGAAGAAATGGATAAATTCTGG + Intergenic
959602248 3:108200508-108200530 CTGAAAAAATGTATATAGTCTGG + Intronic
959631269 3:108510015-108510037 AAGAAGAAAGGGAAAGACTCTGG - Intronic
960467073 3:118009356-118009378 CAGAAGAGATTGAAAGAATCTGG - Intergenic
961680920 3:128599519-128599541 CAGAATAAATAGATACAGGCCGG + Intergenic
962861598 3:139407980-139408002 CAGAAGAAATGGATAAATTCTGG + Intergenic
963090729 3:141481186-141481208 AAGGAGAAAGGGAAAGAGTCAGG - Intergenic
963343040 3:144060648-144060670 CAGAAACAATGGAGAGAGGCAGG + Intergenic
963759419 3:149271990-149272012 CAGAAGGAAGGGAGAGATTCAGG + Intergenic
964939362 3:162136388-162136410 AAAAAGAAATGGAAAAAGTCAGG + Intergenic
965080332 3:164024480-164024502 CAGAAGAGAAGGAAAGAGTGTGG - Intergenic
965266800 3:166553914-166553936 CAGGAGAAATGAAAAGAGACTGG - Intergenic
965384371 3:168028215-168028237 AAGAAGAAATTGATAGTTTCAGG + Intronic
965444174 3:168753988-168754010 CAGATGACATGGAAAGAATCTGG - Intergenic
966436754 3:179894334-179894356 CAGAAGAAATGAATTCTGTCAGG - Intronic
966519678 3:180859605-180859627 TAGAAGAAATGGATAAATCCTGG + Intronic
966587753 3:181646205-181646227 CAGTAGAATAGAATAGAGTCTGG + Intergenic
967550779 3:190792972-190792994 CAGAAGACATGGATGCAGTCTGG - Intergenic
967924990 3:194638995-194639017 CAGAAGCAATGGGAAGAGTGTGG + Intergenic
970669320 4:18377868-18377890 TAGAAGAAATGGATAAAGATGGG + Intergenic
970810041 4:20081733-20081755 TAGAAGAAATGGATAAATCCTGG + Intergenic
971027833 4:22606176-22606198 GAGAAGAAAGGCATAGAGACAGG - Intergenic
971216197 4:24664296-24664318 CAGCAACAATGGATAGAGCCGGG - Intergenic
971270628 4:25141533-25141555 AATAAGAAGTGGTTAGAGTCAGG - Intronic
972808464 4:42555728-42555750 CAGGAGAAATGGCTTGATTCTGG + Intronic
972918965 4:43914487-43914509 TAGAATAAATGGATAAATTCTGG + Intergenic
972935294 4:44127315-44127337 CAGAAGAAAAAGATAAAGACAGG - Intergenic
973680214 4:53309545-53309567 CAGGAGGAATGAACAGAGTCAGG + Intronic
973834885 4:54799583-54799605 TAGAAGAAATGGATAAATTCTGG + Intergenic
973836065 4:54810484-54810506 TAGAAGAAATGGATAAATTCTGG + Intergenic
973883845 4:55300532-55300554 TAGAAGAAATGGATAAATTCTGG + Intergenic
974196490 4:58582354-58582376 TAGAAGAAATGGACAAATTCTGG - Intergenic
974713114 4:65629338-65629360 CATAATAACTGGATAGAGGCAGG + Intronic
974784421 4:66599265-66599287 TAGAGGAAATGGATAAATTCAGG + Intergenic
975105828 4:70568149-70568171 TAGAAGAGATGGATAAATTCTGG - Intergenic
975544026 4:75543704-75543726 CAGAAGAACTGGATAGGTACTGG + Intronic
977946770 4:102922803-102922825 TAGAAGAAATGGATAAATTCTGG + Intronic
978074311 4:104510134-104510156 CAGAAGAACGGGGTAGAGTAGGG + Intergenic
978181101 4:105796939-105796961 CAGAAGAAATGGAGTTAGCCTGG - Intronic
978206472 4:106086329-106086351 TAGAAGAAATGGATACATTCTGG + Intronic
978270449 4:106883188-106883210 TAGAAGAAATGGATACATTCTGG - Intergenic
979838271 4:125402380-125402402 CAGAACAAATGTACAGAGTGTGG + Intronic
980307280 4:131078353-131078375 AGGAAGAAATGCATAGAGTTGGG + Intergenic
980590062 4:134874562-134874584 GAGAAGAGATGGAGAGAGTCTGG - Intergenic
980985502 4:139690963-139690985 CAGAAGAACTGGAAAGAGTCTGG - Intronic
982594830 4:157367694-157367716 AAGAAGAAATGAATAGAGACAGG - Intergenic
982740839 4:159055280-159055302 CAGAAGAAAAGAAAAGAGTCAGG - Intergenic
982969110 4:161958360-161958382 CAGCAGACATGGAAAGAATCAGG - Intronic
983879361 4:172915645-172915667 TAGAAGAAATGGATAAATTCCGG + Intronic
984035811 4:174666192-174666214 CAGATGAAATTTATAGAGCCTGG - Intronic
987430187 5:17823480-17823502 TAGAAGAAATGGATAAATTCCGG + Intergenic
988298139 5:29391641-29391663 CAGAAGAAAAGGAAAGAGCGTGG + Intergenic
990022808 5:51148847-51148869 TAGAAGAAATGGATGAATTCTGG + Intergenic
990230013 5:53702927-53702949 TAGAAGAATTGGATAAATTCCGG - Intergenic
990802653 5:59622560-59622582 CAGAAGAAAGGGAGAGAGATCGG - Intronic
992946823 5:81819336-81819358 CAGAAGAACAGCACAGAGTCTGG + Intergenic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
993728736 5:91397645-91397667 AGGAAGAAAGGGATAGGGTCTGG + Intergenic
994033298 5:95169639-95169661 TAGAAAAAATGGATAAATTCCGG - Intronic
994133067 5:96253231-96253253 CTGAAAATATGGATATAGTCAGG + Intergenic
994990999 5:106997025-106997047 TAGAATAAATGGATAAATTCTGG - Intergenic
995460427 5:112397792-112397814 ATGAAGAAATGAAGAGAGTCAGG + Intronic
995624247 5:114059103-114059125 GAGGAGAAGTGGATAGATTCAGG + Intergenic
996147014 5:119988897-119988919 TAGAAGAAATGGATACAACCTGG - Intergenic
997983130 5:138482658-138482680 CAGATAAACAGGATAGAGTCTGG + Intergenic
998398182 5:141833117-141833139 CAGAAGAGTTTGGTAGAGTCAGG + Intergenic
998896568 5:146806495-146806517 ATGAAGGAATGGAAAGAGTCAGG - Intronic
999109141 5:149102075-149102097 TACAAGAAATGGATAAATTCTGG + Intergenic
999292558 5:150436146-150436168 CATAAGAAATGGATAGGCTGAGG + Intergenic
999581574 5:153044300-153044322 AAAGAGAAATGGATAGATTCTGG + Intergenic
1000401808 5:160836817-160836839 AGGAAAAAATGGATAGAGACTGG - Intronic
1002072101 5:176685474-176685496 GAGAAGAAATAAATAGGGTCTGG + Intergenic
1002288234 5:178179968-178179990 CAGAAGAGATGCATAGAGCGAGG + Intergenic
1003120488 6:3315367-3315389 CAGAGGAAATGCGTAGAGCCAGG + Intronic
1003541232 6:7019799-7019821 CAGATGAGATAAATAGAGTCTGG - Intergenic
1004620342 6:17325765-17325787 CAGAAGAAAAGGAAAGAGTGTGG - Intergenic
1005694315 6:28336799-28336821 CAGAGGAAGTGGACAGACTCGGG - Exonic
1005741149 6:28791788-28791810 GAGAAGAAATGGAGACAGACAGG - Intergenic
1006999990 6:38301603-38301625 TAGAAGAAATGGATAAATTCTGG - Intronic
1007483881 6:42167268-42167290 CAGAAGGGCTGGATAGAGCCAGG - Intronic
1010885443 6:81232481-81232503 CAGGAGAAATGGATTGAGGCAGG + Intergenic
1012067711 6:94570370-94570392 AAGAAGAAATGGATTGTTTCAGG + Intergenic
1012451424 6:99356174-99356196 AAGAAAAAATGGAAAGAGACTGG - Intergenic
1012619570 6:101324860-101324882 CAGAAGCAAAGAATAGAGACTGG + Intergenic
1012747503 6:103112120-103112142 CAGAAGATATAGATATATTCAGG + Intergenic
1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG + Intergenic
1013332016 6:109112267-109112289 TAGAAGACATGGATAAATTCCGG - Intronic
1013542865 6:111128567-111128589 CAGTAGAAATGTTTAGAGTGTGG - Intronic
1014429432 6:121349797-121349819 GATAAGAAATGGACAGATTCTGG - Intergenic
1014695504 6:124616132-124616154 CAGAAGAAGAGGATAGAGTTTGG - Intronic
1015683418 6:135833292-135833314 TGGAGGAAATGGATAGAGTCAGG - Intergenic
1016174869 6:141068761-141068783 CAGAAGAAAAGACTAGAGCCAGG - Intergenic
1016277568 6:142372722-142372744 GAGAAGAAATTGAGAAAGTCAGG + Intronic
1016919382 6:149275998-149276020 CTGAAGAAATGAATAAAGTATGG + Intronic
1018598475 6:165510769-165510791 TAGAGGAAATGGATAAATTCCGG - Intronic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020788122 7:12593863-12593885 CAGAAGAGAAGGAAAGAGTGTGG - Intronic
1021483121 7:21140064-21140086 GAGAGCAAATTGATAGAGTCAGG - Intergenic
1022624124 7:32016473-32016495 TAGAAGAAATGTAAAGAGTATGG - Intronic
1023162275 7:37309002-37309024 CAGGAGAAATGCTTGGAGTCAGG + Intronic
1024487854 7:49940185-49940207 GAGAAGCAATGGATAGAATTGGG - Intronic
1026145432 7:67742554-67742576 CAGAAAAAGTGAGTAGAGTCTGG - Intergenic
1026429598 7:70331291-70331313 TAGAAGAAATGGATAAATTCTGG - Intronic
1028390464 7:90310835-90310857 CAAAACATATGGATAGAGTGGGG + Exonic
1029029669 7:97454288-97454310 CAGAAGATATGGCTGGGGTCTGG + Intergenic
1029040681 7:97570320-97570342 CAGAAGAAAAGGAAAGAGAGAGG + Intergenic
1029234144 7:99099264-99099286 GAGAAGGAATGGAGAGAGGCAGG + Intronic
1029943318 7:104504071-104504093 CAGATGAAAGGAATGGAGTCTGG - Intronic
1031554851 7:123161624-123161646 GAGAAGAGATAGAAAGAGTCAGG + Intronic
1031820733 7:126498040-126498062 GAGAAGAAAAGGATGGATTCTGG + Intronic
1032141269 7:129332728-129332750 CAACAGAAATGCATAAAGTCAGG - Intronic
1033439123 7:141362826-141362848 CAGGAGAAATGGCTACAGCCCGG - Intronic
1034406816 7:150909504-150909526 AAGAAGAAAAGGATTGATTCGGG - Intergenic
1035580390 8:736475-736497 TAGAAGAAATGGACAGCGGCCGG + Intronic
1035711203 8:1716223-1716245 TACAAGAAATGGATAAATTCTGG + Intergenic
1036020727 8:4842474-4842496 CAGATGCAATGGATAGTTTCAGG + Intronic
1036271484 8:7308169-7308191 CTGGAGGTATGGATAGAGTCAGG - Intergenic
1036349864 8:8002180-8002202 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1036845137 8:12162710-12162732 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1036866506 8:12405033-12405055 CTGGAGGTATGGATAGAGTCAGG + Intergenic
1037873029 8:22517603-22517625 CAGAAGAAATGGATAGAGTCTGG - Intronic
1039578826 8:38647198-38647220 CAGAAGAAATTGATGGTTTCAGG - Intergenic
1039638390 8:39192131-39192153 TAGAAGAAATGAATAAATTCTGG - Intronic
1039909102 8:41810175-41810197 AAGCAGAAATGGAAAGAGTTTGG - Intronic
1040750058 8:50694335-50694357 TAGAAGAAATGAATACATTCTGG + Intronic
1040758640 8:50810616-50810638 CAGAAAAAATTGATAAAGGCCGG - Intergenic
1041027084 8:53697901-53697923 TAGAAGACATGGATAAATTCCGG - Intergenic
1041295282 8:56350830-56350852 TAGAAGAAATGGATACATTCCGG - Intergenic
1041446588 8:57958426-57958448 AAGTAGTAATGGAGAGAGTCTGG - Intergenic
1041828183 8:62122310-62122332 CAGTAGAAAGTGGTAGAGTCAGG - Intergenic
1042326809 8:67537437-67537459 TACAAGAAATGGATAAATTCTGG - Intronic
1043692895 8:83179676-83179698 GAGAAGAAATACATAGAGTCTGG + Intergenic
1043848787 8:85192042-85192064 AATAAGAAATGGAGAGATTCTGG + Intronic
1044314292 8:90731499-90731521 TAGAAGAAATGAATACATTCTGG - Intronic
1044693764 8:94902996-94903018 CAAAAGAAATGAATACAGGCTGG - Intronic
1046529741 8:115428030-115428052 CAGAAGACTTGGCTAGAGTTGGG + Intronic
1046595417 8:116255758-116255780 CAGAACAAAAAGATAGAGGCAGG + Intergenic
1047170116 8:122484512-122484534 CTGAACAAATGCTTAGAGTCTGG - Intergenic
1047535793 8:125718649-125718671 CAGTAGAAATGCAGAGAGTGGGG + Intergenic
1047785100 8:128146502-128146524 GAGAAGACAGGGATAGAGCCAGG - Intergenic
1048319778 8:133389344-133389366 CAGAAGAATTGGCTAGAGACTGG - Intergenic
1048591690 8:135826407-135826429 CAGAAGAAATGTTTGGAGTTTGG - Intergenic
1049137600 8:140917840-140917862 CAGAAGAAAAGGATATAGGAGGG + Intronic
1050214750 9:3309954-3309976 CAGAATAAAAGGACAGAGTGGGG + Intronic
1050279864 9:4039154-4039176 CATATGAAATGGGTAGAGTGTGG - Intronic
1050452025 9:5792025-5792047 AAGAAGAGAAGGGTAGAGTCTGG + Intronic
1050735249 9:8754833-8754855 CAATAGAAATGGATAGCTTCAGG - Intronic
1050926455 9:11269403-11269425 GAGAAGCCAGGGATAGAGTCAGG - Intergenic
1051110539 9:13630528-13630550 TAGAAGAAATGGATAAATTCTGG + Intergenic
1051166418 9:14266781-14266803 CAACAGGAATGGATAGATTCTGG - Intronic
1051878030 9:21811300-21811322 TAGAAGAAATAGACAGAGTAGGG + Intronic
1051885991 9:21893646-21893668 TAGAAGGAATGGATAAATTCTGG + Intronic
1052122242 9:24731587-24731609 CAGAAGGAGTTGATAGAGGCAGG - Intergenic
1052838148 9:33266520-33266542 CAGAAGAGATGCTTACAGTCTGG + Intronic
1052899943 9:33784891-33784913 CAGGAGTAAGTGATAGAGTCAGG - Intronic
1052998661 9:34565392-34565414 CAGAGGAAAGGGAGAGAGACAGG - Intronic
1055172067 9:73270796-73270818 CAGGACAAAAGAATAGAGTCAGG + Intergenic
1055343033 9:75305718-75305740 TAGAAGAAATGGATATAGTCTGG - Intergenic
1055509495 9:76981742-76981764 TAGAAGAAATGGATAAATTCTGG - Intergenic
1055659116 9:78484170-78484192 CAGTAGACATGCAAAGAGTCAGG - Intergenic
1056804741 9:89719877-89719899 CAGCAGACCTGGATAGAGTAAGG - Intergenic
1057564852 9:96158613-96158635 CACAAGAGGTGGATAGATTCTGG - Intergenic
1058148554 9:101438650-101438672 CAGAAGAAATATCTAGAGTTGGG - Intergenic
1058262600 9:102854343-102854365 CATAAGAAATGCATAGATTTTGG + Intergenic
1059139331 9:111837366-111837388 AAGAAGAAAGGGAAAGAGACAGG - Intergenic
1059468944 9:114488932-114488954 CAGAAGCAATGGGGAGAGTTTGG - Intronic
1059770004 9:117415355-117415377 CAGGAGAACTGGGTTGAGTCAGG - Intergenic
1061296422 9:129679279-129679301 CACAAGGAATGGAGGGAGTCCGG + Intronic
1185887259 X:3793780-3793802 CAGAAGATTTGGATAGAACCAGG + Intergenic
1187277651 X:17830030-17830052 CAAAAGGAAAGGATAGAGTTGGG - Intronic
1188381757 X:29503038-29503060 TAGAAGAAATGGATAAATTCTGG - Intronic
1189724461 X:43954633-43954655 TAGGAGAAATGGAGGGAGTCAGG - Intronic
1189796484 X:44650740-44650762 TAAAAGAAATGGAGAGAGGCTGG + Intergenic
1190401016 X:50035006-50035028 ATGAACAAATGGATAGAGACAGG - Intronic
1191208395 X:57858362-57858384 TAGAAGAAATTGATAAATTCCGG + Intergenic
1191819039 X:65282720-65282742 TATAAGAAATGGATAAATTCTGG + Intergenic
1191934082 X:66407581-66407603 CAGAAGCAAGGGAGAGAGTTGGG + Intergenic
1192018850 X:67362395-67362417 TAGAAGAAATGGATAAATTCTGG + Intergenic
1192709430 X:73564141-73564163 AAAAAGAAATGGATTGAGTCAGG + Intronic
1192913329 X:75628791-75628813 TAGAAGAGATGGATAAATTCCGG - Intergenic
1193466067 X:81849153-81849175 CAGAAGAAAAGGATATAGACTGG + Intergenic
1194228875 X:91297257-91297279 TAGAAGAAATGGCTAAATTCTGG - Intergenic
1194247309 X:91531770-91531792 CAGAAGAAATGGACAGATTCTGG - Intergenic
1194390995 X:93317963-93317985 GAGAAGAGATAGAAAGAGTCAGG - Intergenic
1195623846 X:106987079-106987101 AAGGAGAAATGAATAGAGTTTGG + Intronic
1195763292 X:108270230-108270252 CAAATGACATGGATAGAGTAGGG - Intronic
1196150667 X:112369833-112369855 GTTAAGAAATGGATAGATTCTGG + Intergenic
1196218721 X:113086808-113086830 TAGAAGAAATGGATAAATCCTGG - Intergenic
1196537372 X:116863132-116863154 GAAAAGAAAAGGAAAGAGTCAGG - Intergenic
1197057500 X:122138504-122138526 CAGAACAAATTGATGAAGTCTGG + Intergenic
1197564228 X:128061795-128061817 CAGAAGAAATGGATAAATTCTGG + Intergenic
1198818669 X:140621258-140621280 CTGAAGAAAAGGATAGATTTGGG - Intergenic
1200178408 X:154134790-154134812 CAGACCAAATGGAGAGAGTATGG + Intergenic
1200566331 Y:4773307-4773329 CAGAAGAAATGGACAGATTCTGG - Intergenic
1201144260 Y:11054493-11054515 AAGAAAAAATGGAGAGAGTGAGG + Intergenic
1201182454 Y:11362186-11362208 TAGAAGAAATGGATAAATTCTGG + Intergenic
1201298481 Y:12485949-12485971 GAGAAGAAAAGGAAAGAGACAGG - Intergenic
1202041753 Y:20692733-20692755 TAGAGGAAATGGATAAATTCCGG - Intergenic
1202270465 Y:23067239-23067261 CAGAAGAAATGAAAAGAAACTGG - Intergenic
1202295562 Y:23353443-23353465 CAGAAGAAATGAAAAGAAACTGG + Intergenic
1202423459 Y:24700983-24701005 CAGAAGAAATGAAAAGAAACTGG - Intergenic
1202447330 Y:24969102-24969124 CAGAAGAAATGAAAAGAAACTGG + Intergenic