ID: 1037875694

View in Genome Browser
Species Human (GRCh38)
Location 8:22546693-22546715
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037875693_1037875694 24 Left 1037875693 8:22546646-22546668 CCAAGGATAAAAATAGTTTTGTA 0: 1
1: 0
2: 0
3: 42
4: 376
Right 1037875694 8:22546693-22546715 TGTGATCCTAATAATAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr