ID: 1037876199

View in Genome Browser
Species Human (GRCh38)
Location 8:22549828-22549850
Sequence CTTTGTGAGAAACAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037876190_1037876199 0 Left 1037876190 8:22549805-22549827 CCTTACCCATGGCTGCCACCTCC 0: 1
1: 0
2: 2
3: 43
4: 435
Right 1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG No data
1037876185_1037876199 13 Left 1037876185 8:22549792-22549814 CCAGTCCCCAGCTCCTTACCCAT 0: 1
1: 0
2: 3
3: 73
4: 419
Right 1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG No data
1037876187_1037876199 8 Left 1037876187 8:22549797-22549819 CCCCAGCTCCTTACCCATGGCTG 0: 1
1: 0
2: 1
3: 20
4: 333
Right 1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG No data
1037876192_1037876199 -6 Left 1037876192 8:22549811-22549833 CCATGGCTGCCACCTCCCTTTGT 0: 1
1: 0
2: 4
3: 40
4: 413
Right 1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG No data
1037876189_1037876199 6 Left 1037876189 8:22549799-22549821 CCAGCTCCTTACCCATGGCTGCC 0: 1
1: 0
2: 3
3: 26
4: 269
Right 1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG No data
1037876191_1037876199 -5 Left 1037876191 8:22549810-22549832 CCCATGGCTGCCACCTCCCTTTG 0: 1
1: 0
2: 3
3: 27
4: 282
Right 1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG No data
1037876188_1037876199 7 Left 1037876188 8:22549798-22549820 CCCAGCTCCTTACCCATGGCTGC 0: 1
1: 0
2: 2
3: 16
4: 251
Right 1037876199 8:22549828-22549850 CTTTGTGAGAAACAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037876199 Original CRISPR CTTTGTGAGAAACAGGAAGT GGG Intronic
No off target data available for this crispr