ID: 1037877311

View in Genome Browser
Species Human (GRCh38)
Location 8:22554429-22554451
Sequence CTGTGGGGAAGGAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2262
Summary {0: 1, 1: 1, 2: 16, 3: 232, 4: 2012}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037877311_1037877316 -9 Left 1037877311 8:22554429-22554451 CCTTCCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 16
3: 232
4: 2012
Right 1037877316 8:22554443-22554465 TCCCCACAGAGGACACGCAGAGG 0: 1
1: 0
2: 3
3: 15
4: 176
1037877311_1037877320 0 Left 1037877311 8:22554429-22554451 CCTTCCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 16
3: 232
4: 2012
Right 1037877320 8:22554452-22554474 AGGACACGCAGAGGAGCAGCTGG 0: 1
1: 0
2: 6
3: 40
4: 354
1037877311_1037877321 9 Left 1037877311 8:22554429-22554451 CCTTCCTTCCTCCTTCCCCACAG 0: 1
1: 1
2: 16
3: 232
4: 2012
Right 1037877321 8:22554461-22554483 AGAGGAGCAGCTGGCTTGCCCGG 0: 1
1: 0
2: 4
3: 32
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037877311 Original CRISPR CTGTGGGGAAGGAGGAAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr