ID: 1037877775

View in Genome Browser
Species Human (GRCh38)
Location 8:22556814-22556836
Sequence GGACCAAGGACAGCAAGCGT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037877764_1037877775 15 Left 1037877764 8:22556776-22556798 CCCTGCCTCCCAGCACACCCAGA 0: 1
1: 1
2: 7
3: 58
4: 588
Right 1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG 0: 1
1: 0
2: 0
3: 11
4: 105
1037877766_1037877775 10 Left 1037877766 8:22556781-22556803 CCTCCCAGCACACCCAGAACTGG 0: 1
1: 0
2: 0
3: 38
4: 358
Right 1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG 0: 1
1: 0
2: 0
3: 11
4: 105
1037877769_1037877775 6 Left 1037877769 8:22556785-22556807 CCAGCACACCCAGAACTGGTCAG 0: 1
1: 0
2: 0
3: 12
4: 177
Right 1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG 0: 1
1: 0
2: 0
3: 11
4: 105
1037877768_1037877775 7 Left 1037877768 8:22556784-22556806 CCCAGCACACCCAGAACTGGTCA 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG 0: 1
1: 0
2: 0
3: 11
4: 105
1037877772_1037877775 -3 Left 1037877772 8:22556794-22556816 CCAGAACTGGTCAGCCACGTGGA 0: 1
1: 0
2: 1
3: 6
4: 62
Right 1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG 0: 1
1: 0
2: 0
3: 11
4: 105
1037877770_1037877775 -2 Left 1037877770 8:22556793-22556815 CCCAGAACTGGTCAGCCACGTGG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG 0: 1
1: 0
2: 0
3: 11
4: 105
1037877765_1037877775 14 Left 1037877765 8:22556777-22556799 CCTGCCTCCCAGCACACCCAGAA 0: 1
1: 0
2: 4
3: 57
4: 494
Right 1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG 0: 1
1: 0
2: 0
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037877775 Original CRISPR GGACCAAGGACAGCAAGCGT CGG Exonic
906216429 1:44043652-44043674 GGCCCAAGGACAGAGAGCTTGGG - Intergenic
917077455 1:171220249-171220271 GGACTAAGGAAAGAAAGCCTCGG + Intergenic
917223138 1:172753037-172753059 TGACCAAAGAGAGCAAGCTTAGG - Intergenic
917280699 1:173375990-173376012 GGACCAAGCACAGAGAGGGTTGG - Intergenic
920205147 1:204286018-204286040 CCACCAAGGACAGCAGGCTTAGG + Intronic
1063174099 10:3536018-3536040 GGACCTAGGACACCAAATGTGGG + Intergenic
1067147392 10:43703335-43703357 AGGCCAAGGACAGCATGCGAAGG + Intergenic
1069920641 10:71813457-71813479 GGACCAAAGACAGCAATGGGTGG + Intronic
1070491410 10:76980412-76980434 GGACCAAGGACACCAAATTTCGG + Intronic
1071023291 10:81083365-81083387 GGCCCAAGGACAGGAAGGGCCGG + Intergenic
1072301501 10:94066583-94066605 GGACCAAGGACAGCATTCCTTGG + Intronic
1075249630 10:120854648-120854670 GAACAGAGAACAGCAAGCGTTGG - Intronic
1075730224 10:124631432-124631454 GACCCAAGGAAGGCAAGCGTGGG + Intronic
1079735704 11:23994394-23994416 AGTCCAAGGGCAGCAAGGGTGGG - Intergenic
1080718897 11:34830383-34830405 GGGCCAAAGACAACAACCGTTGG + Intergenic
1081651540 11:44827309-44827331 GGAACAAGACCAGCAAGCCTTGG + Intronic
1083079575 11:60076666-60076688 AGACCAAAGATAGCAAGTGTTGG + Intergenic
1084278542 11:68070346-68070368 GCCCCAAGAACAGCAAGCCTTGG - Intronic
1084568442 11:69944701-69944723 GGCCCACAGACAGCAGGCGTGGG - Intergenic
1085252228 11:75151421-75151443 GGGCCATGGAGAGCAAGCCTGGG + Intronic
1090067914 11:123519142-123519164 GTACCAAGGACAGGAAGGGAGGG + Intergenic
1091128968 11:133128077-133128099 GGACTAAGGACAGCAAGGAGGGG - Intronic
1093336676 12:17912915-17912937 GGGCCACGGACAGCAGGAGTGGG + Intergenic
1093820658 12:23613982-23614004 GGCCCAAGGACAGCAGGTTTGGG + Intronic
1096562723 12:52448259-52448281 AGACCAAGGACATTAAGTGTTGG + Intronic
1097557079 12:61151797-61151819 AGACTAATGACAGCAAGGGTGGG + Intergenic
1097688842 12:62715296-62715318 GGACCAATGACACCATGCGCAGG + Intronic
1101753505 12:107602831-107602853 GGCCTGAGGACAGCAAGCGATGG - Intronic
1102317419 12:111900541-111900563 GGCCCAGGGGCCGCAAGCGTAGG + Intergenic
1102556500 12:113730111-113730133 GCACCAAGGAAAGCAAGCTGTGG - Intergenic
1102930470 12:116858239-116858261 GGACCATGGACAGCAGCCATTGG + Exonic
1103897080 12:124279897-124279919 GGTCCTGGGACAGCCAGCGTGGG + Intronic
1110692546 13:78448011-78448033 GGAGCCAGGACAGAAAGGGTGGG + Intergenic
1122898610 14:104772747-104772769 TGGCCAAGGACATCAAGCTTTGG + Intronic
1124425743 15:29561086-29561108 TGACAAAAGACAGCAAGTGTTGG + Intronic
1128659788 15:69490452-69490474 AGAACCAGGAGAGCAAGCGTGGG - Intergenic
1131625844 15:94119628-94119650 GGACCAAGGACACCAGGAGCTGG - Intergenic
1132626194 16:892731-892753 GGACCAAGGACAGCAGCGGAGGG + Intronic
1132732919 16:1371710-1371732 AGACCAAGGGCAGAAGGCGTGGG + Intronic
1132750771 16:1456502-1456524 GGACAAAGAACAGCAAGGCTGGG - Intronic
1133116811 16:3582255-3582277 GGACCTGGGACACCCAGCGTGGG - Exonic
1139851077 16:69951851-69951873 AGACCAGGTACAGCAGGCGTGGG - Intronic
1139880057 16:70174763-70174785 AGACCAGGTACAGCAGGCGTGGG - Intronic
1140372454 16:74420754-74420776 AGACCAGGTACAGCAGGCGTGGG + Intronic
1143644782 17:8223234-8223256 GGTCCAAGGACCGCAGGCGGAGG - Intergenic
1147440666 17:40445443-40445465 GGTCCCAGGACAGGAAGCTTGGG - Intronic
1147933313 17:43996316-43996338 GGAGCTGGGACAGCAAGGGTGGG - Intronic
1151727177 17:75891971-75891993 GGACCCAGGACAGCAGGGGGAGG + Intronic
1152656091 17:81519784-81519806 GGACCCCGGACATCTAGCGTGGG - Intronic
1153670651 18:7408888-7408910 AGACAAAGGATAGCAAGTGTTGG - Intergenic
1154025861 18:10706449-10706471 GGGCCAAGGAGAGCTTGCGTGGG - Intronic
1158513752 18:58113956-58113978 GGACAGAGGACAGAAAACGTGGG - Intronic
1160554816 18:79718167-79718189 GGACCCAAGACTGCAAGCGGGGG - Intronic
1161066155 19:2238858-2238880 GGAGCAAGGACAGGAAGGTTTGG - Intronic
1161227218 19:3152287-3152309 GGAGCCAGGACAGCGGGCGTGGG + Intronic
1162524193 19:11197805-11197827 GGCCCAGGGACAGCAGGCGGTGG - Intergenic
1163263325 19:16204258-16204280 GGCCCAAGGACAGGAAGGGTGGG - Intronic
1164853073 19:31500645-31500667 GGACCAAGGACAGGAGGCCTGGG + Intergenic
1165322868 19:35096985-35097007 GGACCCAGGACAGCCGGCCTGGG + Intergenic
1166872324 19:45878379-45878401 GGCCCACGGTCAGCAAGGGTGGG - Intergenic
1167747932 19:51363794-51363816 GGACAAAGGACAGAAAGCAGAGG + Intronic
925262988 2:2544119-2544141 GGCCCACGGACAGCAAGCACCGG - Intergenic
927569451 2:24145221-24145243 GGACCAAGGACAGGCACCCTTGG + Intronic
927914234 2:26924744-26924766 GGACCAAGGGCAGCGAGGTTTGG - Intronic
929589217 2:43134343-43134365 GGTCTAAGGACAGCCAGCCTGGG + Intergenic
929919506 2:46162239-46162261 GGCCCAAGGACAGAAAGCACAGG - Intronic
931652523 2:64481391-64481413 GGAGCAAGGACAGAAAACTTTGG + Intergenic
934937639 2:98476905-98476927 GGATCAAGGACAGCAAGGAAGGG - Intronic
936270474 2:111044912-111044934 GGATCAAGGAGAGGAAGCATAGG - Intronic
937098060 2:119248499-119248521 GCGCAAAGGAAAGCAAGCGTGGG + Intronic
943807260 2:192137576-192137598 GGAGCAAGGAGAGCAGGCATAGG + Intronic
946078256 2:217094033-217094055 GGACAAAAGACAACAAGTGTTGG + Intergenic
948817377 2:240519419-240519441 GGAAGTATGACAGCAAGCGTGGG - Intronic
1169464321 20:5823975-5823997 AGACCAAGGAGGGCAAGCATGGG - Intronic
1170324341 20:15139709-15139731 GGACCTAGGAGAGCAGGTGTTGG + Intronic
1172696103 20:36824044-36824066 GGTCCTAGGAGAGCAAGGGTGGG + Intronic
1175790097 20:61735533-61735555 GGACCAAGCACAGGAAACCTGGG + Intronic
1175953666 20:62596969-62596991 GGCCCCACGACAGCAAGCGTTGG - Intergenic
1178999779 21:37446137-37446159 GCAACAAGGACAGCAGGTGTGGG - Intronic
1181044993 22:20210259-20210281 GGACCATGGACAACAGGCGGAGG - Intergenic
1185265797 22:49903420-49903442 GGCCCTCGGGCAGCAAGCGTGGG + Exonic
950208984 3:11103724-11103746 AGACCAAAGACAACAAGTGTTGG - Intergenic
951134461 3:19087947-19087969 GTACCAAGGAATGCAATCGTTGG - Intergenic
954128646 3:48548246-48548268 GGACCAAGGCCAGAAAGTGATGG - Intronic
962050164 3:131805203-131805225 GCACCAAGGAGAGCAAGCGATGG - Intronic
968910944 4:3476685-3476707 GGACCTTGGACATCGAGCGTGGG - Intronic
969466785 4:7362018-7362040 GGACAAAGGACAGCAAACTTGGG + Intronic
979251274 4:118568912-118568934 AGACGAAAGACAGCAAGTGTTGG - Intergenic
981670638 4:147282799-147282821 AGACCAAAGATAGCAAGTGTTGG + Intergenic
988873863 5:35421946-35421968 AGACAAAGGATAACAAGCGTTGG + Intergenic
990772773 5:59268457-59268479 GGCACAATGACAGCAAGCCTGGG - Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
999512502 5:152267375-152267397 GGTCCAAGGACTGCATGCTTAGG - Intergenic
1008652036 6:53573627-53573649 GGACGAAGGAGAGCAAGCCTTGG - Intronic
1016510698 6:144839755-144839777 TGACCAAGGACAGGCTGCGTGGG - Intronic
1016598573 6:145829324-145829346 GGACCAAGGCCAGCATGGCTCGG - Intergenic
1018859380 6:167699543-167699565 GGCCCTGGGACAGCAAGGGTGGG + Intergenic
1031216411 7:118898792-118898814 GGACCCAGGACATCAAGCTTTGG - Intergenic
1034792680 7:153985563-153985585 GGACTAAGGAAAGAAAGAGTTGG + Intronic
1037400157 8:18487645-18487667 AAACAAAGGAAAGCAAGCGTTGG + Intergenic
1037877775 8:22556814-22556836 GGACCAAGGACAGCAAGCGTCGG + Exonic
1038291355 8:26252542-26252564 GGGCCAAGGACACAAAGCCTTGG - Intergenic
1038441803 8:27575842-27575864 GGACCACAGACAGCATGGGTGGG - Intergenic
1039836020 8:41256869-41256891 GGCCCAAGGACAACCAGGGTGGG - Intergenic
1041177227 8:55209301-55209323 GGAACGAGGACAGCAAGTGTGGG - Intronic
1041395022 8:57381238-57381260 GGTCCAAGGACAGGAAGCTTTGG - Intergenic
1047864811 8:129011136-129011158 GGAAAAAGGACAGCAAACATTGG + Intergenic
1048309442 8:133307634-133307656 GTACCAAGGAAAACAAGCTTGGG - Intergenic
1048845570 8:138601411-138601433 GGACCATGGAAAACAAGCGGGGG + Intronic
1048954852 8:139527169-139527191 GGAGCAAGGACAGCTACAGTGGG + Intergenic
1049031643 8:140042614-140042636 GGGCCGTGGAGAGCAAGCGTAGG - Intronic
1060842544 9:126805147-126805169 GGACCACGGGCGGCAAGGGTAGG + Intronic
1062174460 9:135153283-135153305 GGAACAGGGACAGCAAACGTGGG - Intergenic
1190913709 X:54794446-54794468 GGACCAAAAAGAGCAGGCGTGGG - Intronic
1192220746 X:69195852-69195874 GCACCAAGGACAGGGTGCGTGGG + Intergenic
1192235222 X:69291318-69291340 GTCCCATGGACAGCAAGCGGTGG - Intergenic
1193327333 X:80194636-80194658 AGACAAAGGAAAGCAAGAGTTGG - Intergenic