ID: 1037884279

View in Genome Browser
Species Human (GRCh38)
Location 8:22588249-22588271
Sequence AACTGCTGGTAGCAGCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037884270_1037884279 27 Left 1037884270 8:22588199-22588221 CCTATAGAACGTTTTACTGGAGA 0: 1
1: 0
2: 1
3: 8
4: 87
Right 1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG 0: 1
1: 0
2: 0
3: 16
4: 137
1037884273_1037884279 3 Left 1037884273 8:22588223-22588245 CCCTGAGAGCAGAGGGATGCGAG 0: 1
1: 0
2: 3
3: 39
4: 197
Right 1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG 0: 1
1: 0
2: 0
3: 16
4: 137
1037884274_1037884279 2 Left 1037884274 8:22588224-22588246 CCTGAGAGCAGAGGGATGCGAGG 0: 1
1: 1
2: 4
3: 50
4: 365
Right 1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG 0: 1
1: 0
2: 0
3: 16
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037884279 Original CRISPR AACTGCTGGTAGCAGCCTGG TGG Intronic
902668394 1:17954905-17954927 AAATGCTGGCAGCAACCTGAAGG - Intergenic
905434898 1:37949466-37949488 ACCTGCTGGGAGCAGCCGTGGGG - Intergenic
905513432 1:38542712-38542734 GGCTCCTGGTAGCAACCTGGAGG + Intergenic
915236844 1:154489638-154489660 AACTGCAAGTGGCACCCTGGAGG - Intronic
918148098 1:181775459-181775481 AACTCTTGGTAGCAGCATGTAGG - Intronic
922595605 1:226810512-226810534 AACTGGTGGCAGCAGCTTGGCGG + Intergenic
1062972466 10:1659709-1659731 AACTACTGGAAGCAGCATGATGG - Intronic
1064703132 10:18042639-18042661 AACTGCTGGGAAAAGCTTGGTGG - Intronic
1067065627 10:43102545-43102567 AACTGGTGGAAGGTGCCTGGGGG - Exonic
1067758930 10:49028384-49028406 AACAGCAGGTAGCAGCCTCTGGG + Intronic
1067795730 10:49320340-49320362 AGGTGCTGGCAGGAGCCTGGTGG - Intronic
1068023774 10:51617391-51617413 CACTGGTGGTAGCAGCAGGGTGG + Intronic
1069210982 10:65760235-65760257 AGCTGGTGAAAGCAGCCTGGAGG - Intergenic
1069629076 10:69886926-69886948 AACTGCTAGGAGAAGCCTGCTGG + Intronic
1069909465 10:71750688-71750710 AACTGCTGGTAGGAGGCAGCTGG + Exonic
1076264964 10:129102583-129102605 AACTTCTGACAGCAGGCTGGAGG - Intergenic
1077155927 11:1090757-1090779 CACCGGGGGTAGCAGCCTGGTGG - Intergenic
1077472786 11:2772082-2772104 TATTGCTGGGAGCAGCATGGAGG + Intronic
1077499200 11:2901720-2901742 AACTGCTCCTAGCAGCCTCCGGG + Intronic
1078808288 11:14730145-14730167 AACTGATGGTAGCAACATCGAGG - Intronic
1078993254 11:16670351-16670373 TACTGCTGGTATGAGCTTGGAGG - Intronic
1079679148 11:23271668-23271690 AACTGGTAGCAGCAGCTTGGAGG - Intergenic
1081202718 11:40237341-40237363 CACTGCAGTTATCAGCCTGGTGG + Intronic
1088235564 11:107719232-107719254 ATCTACTGGGAGCAGCCTGTGGG + Intronic
1088689212 11:112311071-112311093 ATCTGCTGGTTACAGCCTGGGGG + Intergenic
1092155769 12:6280709-6280731 AACTTCTGGAAGCAGCCATGTGG - Intergenic
1092882877 12:12901415-12901437 AACCAAGGGTAGCAGCCTGGGGG + Intronic
1096518372 12:52170672-52170694 AGCTGCTGGGAGCTGGCTGGGGG + Exonic
1096535579 12:52270671-52270693 ACCAGCTGGGAGCAGCCAGGAGG - Intronic
1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG + Intergenic
1098052132 12:66465354-66465376 AACTCCTGGTGCCAGCCTTGGGG - Exonic
1106052347 13:26203565-26203587 CACTGCTAGGAGCTGCCTGGGGG - Intronic
1106141471 13:27015318-27015340 ACCTGCTGGAAGGAGCCAGGGGG + Intergenic
1107175517 13:37394530-37394552 AAGAGCTGGTACCAGCCTGAGGG - Intergenic
1109811648 13:67520476-67520498 AACTGCTGAGAGCAGCCAGTAGG + Intergenic
1113389827 13:109884840-109884862 CAGTGCTGGGAGCAGCCTAGTGG - Intergenic
1118049332 14:62009729-62009751 AACTGCTGATAGCAGAGTGAGGG - Intronic
1120107866 14:80516795-80516817 AACTTCTGGCAGCAGCCACGTGG - Intronic
1121541152 14:94727772-94727794 CACAGCTGGTTCCAGCCTGGAGG - Intergenic
1121546053 14:94764568-94764590 AGCTGCTGTTAGCAGTCTGCTGG - Intergenic
1122155712 14:99749230-99749252 CACCGCTGGAAACAGCCTGGCGG - Intronic
1122663328 14:103312225-103312247 ACTGGCTGGGAGCAGCCTGGGGG - Intergenic
1123540523 15:21285250-21285272 AACAGCTGGCAGCAGCAGGGAGG + Intergenic
1124431486 15:29612476-29612498 CTCTGCTGGTAGCAGGCTGAAGG - Intergenic
1124713232 15:32031657-32031679 AACTGATGGCAGCTGCCTGGAGG - Intronic
1125574137 15:40743942-40743964 AACTGCTGACAGCATCTTGGTGG + Intronic
1125607315 15:40948061-40948083 GACTGCTGGTAGTAACATGGTGG - Intergenic
1126515056 15:49524681-49524703 AGCTGGTGAAAGCAGCCTGGAGG + Intronic
1128361216 15:66963153-66963175 CACTGCCGGCAGCATCCTGGAGG - Intergenic
1128745889 15:70113845-70113867 ACCTGCTGGTAGCAGCAGAGTGG - Intergenic
1129449740 15:75644478-75644500 CTCTGCTGGTGGCAGCCTGCAGG - Intronic
1131753556 15:95536509-95536531 AAGTGCTTGAAGCAGCCTGATGG + Intergenic
1202948837 15_KI270727v1_random:12392-12414 AACAGCTGGCAGCAGCAGGGAGG + Intergenic
1133270748 16:4609812-4609834 AGCTGCTGGTGGCGGCATGGGGG + Exonic
1139434107 16:66926284-66926306 AGTTGCTGGCAGCTGCCTGGTGG - Intergenic
1142130233 16:88428832-88428854 TACTCCTGGTGGCAGCCAGGGGG - Exonic
1143015189 17:3887833-3887855 ACCTGCTGGGAGGAGCCTGGCGG - Intronic
1149048525 17:52276785-52276807 AACTCCAGGTAGCAGCCTGTAGG + Intergenic
1149226592 17:54478581-54478603 GACTGCTGGTAGTAACATGGCGG + Intergenic
1151455909 17:74225741-74225763 AGGTGCTGGTAGGAGACTGGAGG - Intronic
1151634096 17:75332192-75332214 CACTGCTCCCAGCAGCCTGGAGG + Intronic
1152025247 17:77804755-77804777 GACTGCTGGCAGCAGCTTAGGGG - Intergenic
1152215627 17:79030273-79030295 AATTGCTGTTGGCAGCCTGGTGG + Intronic
1152576695 17:81144286-81144308 AGCTGCAGATAGGAGCCTGGGGG + Intronic
1158459006 18:57631577-57631599 AACTGCTGAGAGCTGCTTGGTGG + Intergenic
1159038429 18:63299485-63299507 TACTGCTGGTAGCAGTGTGTTGG - Intronic
1163871800 19:19827888-19827910 GACTGCTGGTAGTAACATGGTGG + Intergenic
1164028741 19:21380789-21380811 GACTGCTGGTAGTAACATGGTGG - Intergenic
1164578297 19:29418864-29418886 GCCTGCTGGTGGCAGCCTGTTGG + Intergenic
1164633331 19:29775699-29775721 AACTTCTGGGAGCAGCCGAGGGG - Intergenic
1164681818 19:30139606-30139628 AAGTGCTGGTGGCAGCTTGCGGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1164881773 19:31738876-31738898 TACTGCAGGTAGCATCCTGTGGG - Intergenic
1166862399 19:45817913-45817935 AGCTGCTGTCTGCAGCCTGGAGG + Intronic
926135101 2:10330904-10330926 AGCTTCTGGGTGCAGCCTGGGGG + Intronic
926156153 2:10455035-10455057 AAGTGCTGGTGGGAGCCTGGAGG - Intergenic
928127933 2:28629033-28629055 TACTGCTGGGAGGAACCTGGGGG - Intronic
928950758 2:36811170-36811192 ATCTGCTGATATGAGCCTGGTGG - Intronic
932690341 2:73907782-73907804 AACTGCTGCTAGCATCCAGTGGG + Intronic
934037529 2:88100741-88100763 AGCAGCTGGTAGCAGGCAGGAGG + Intronic
934125524 2:88885484-88885506 AACAGCTGGTCGTGGCCTGGAGG - Intergenic
935865876 2:107387290-107387312 TAATGCTGGTAACAGACTGGTGG - Intergenic
940468560 2:154064026-154064048 ATCTGCTGGCAGCAGCCCAGTGG + Intronic
942046108 2:172100415-172100437 CACTGCAGGTCGCAGCCTGCAGG + Exonic
945012272 2:205478213-205478235 AATTTCTGGCATCAGCCTGGAGG + Intronic
948124069 2:235552038-235552060 ACCTGCTGGAAGGAGCCTGCAGG + Intronic
1172148660 20:32775362-32775384 TGCTGCTGGTATCAGCCTGGAGG + Intronic
1172754385 20:37273106-37273128 AAATGTTGCCAGCAGCCTGGTGG + Intergenic
1180612509 22:17107169-17107191 AAATGTTGCAAGCAGCCTGGTGG + Intronic
1180661907 22:17475111-17475133 CACTGGTGGGAGCAGCGTGGGGG + Intronic
1181081328 22:20417758-20417780 AAGTGGGGGTAACAGCCTGGGGG - Intergenic
1181508775 22:23379586-23379608 AACTGATGGGGGCAGCCTGCAGG - Intergenic
1183321566 22:37167982-37168004 ACCTGCTGGCAGCAGCATGCTGG + Intronic
1185298334 22:50065474-50065496 AAATGGTGGTCTCAGCCTGGCGG - Intronic
949379778 3:3431683-3431705 CATTGCTAGGAGCAGCCTGGGGG + Intergenic
949516520 3:4812397-4812419 AGCTACTGCTAGCAGTCTGGAGG - Intronic
949781163 3:7690190-7690212 AAATGCAGGAAGCAGCCTGAGGG + Intronic
950018043 3:9768117-9768139 AGCAGCTGGTAGAAGCCTGGAGG + Intronic
950706573 3:14786068-14786090 ACCTGCTGGCAGGAGTCTGGGGG - Intergenic
952250530 3:31648717-31648739 CAGTGCTGGTAGTGGCCTGGTGG - Intergenic
952698680 3:36302429-36302451 AGCTGCAGGAAGCAGGCTGGGGG - Intergenic
954069914 3:48135412-48135434 AGCTGCTGGTGGGAGGCTGGGGG - Intergenic
954624349 3:52014488-52014510 GGCTGTTGGTAGAAGCCTGGAGG + Intergenic
956162957 3:66373932-66373954 AGGTGCTGGGAGCAGCCTGCAGG + Intronic
960148985 3:114232179-114232201 AACTGTTGGTAGCAGTAGGGTGG + Intergenic
960914004 3:122679314-122679336 ATCTGCAGGTAGCAAGCTGGAGG + Intergenic
966140779 3:176753211-176753233 ATGGGCTGGGAGCAGCCTGGGGG - Intergenic
966780068 3:183576561-183576583 AACTGCAGGAAGCAGCTTGTAGG + Intergenic
967475029 3:189906770-189906792 ATCTGCTGTTTGCAGGCTGGAGG + Intergenic
967706592 3:192658407-192658429 AACTGCTGGTAGCAGCATTTAGG - Intronic
968871308 4:3244101-3244123 CCCTGCTGGCAGCTGCCTGGGGG - Intergenic
968920645 4:3520766-3520788 AGTTACTGGTAGCAGCCAGGAGG + Intronic
969706263 4:8793962-8793984 CCCTGCTTGGAGCAGCCTGGCGG - Intergenic
975033138 4:69648842-69648864 AACTGCTGGTAGCAGTCTTAAGG + Intronic
978413497 4:108451013-108451035 AACTGCTGTTCACAGCCGGGTGG - Intergenic
985043461 4:185916327-185916349 AACTTCTGGTTGCTGCCTGGTGG - Intronic
986406310 5:7428148-7428170 AACTGCTGGTAGCAGGTTGATGG + Intronic
988412785 5:30908608-30908630 ATCGGCTGGTAGCAGCTTGGGGG + Intergenic
991280133 5:64904089-64904111 AACTGTTTGTAGAAGCATGGTGG - Intronic
999236583 5:150101569-150101591 GACGGCTGGTGGCAGACTGGTGG - Intronic
1000126259 5:158246778-158246800 AACTGCTATTAACAGCCTGGTGG - Intergenic
1003279068 6:4676323-4676345 AACTGCTTCAAGCTGCCTGGTGG - Intergenic
1003290318 6:4775082-4775104 AACTGGTGGGAGGAGCCTTGTGG + Intronic
1005117207 6:22351999-22352021 AACTTCAGGTAGCACCATGGAGG - Intergenic
1005659229 6:27977577-27977599 GACTGATGGCTGCAGCCTGGGGG + Intergenic
1005663783 6:28027987-28028009 AACTGCTGGCAAAAGCTTGGAGG - Intergenic
1009039913 6:58163788-58163810 AACTGCTGTTAACAAGCTGGAGG - Intergenic
1014210916 6:118707132-118707154 GACTGCTGGGACCAGCCTGGAGG - Intronic
1019595619 7:1857049-1857071 AGCTGCGGGGAGCAGACTGGTGG + Intronic
1022703703 7:32784257-32784279 AATTCCTTGTAGCAGCCTGATGG - Intergenic
1022907943 7:34874382-34874404 AATTCCTTGTAGCAGCCTGATGG - Intronic
1022945835 7:35282573-35282595 TCTGGCTGGTAGCAGCCTGGGGG + Intergenic
1024185807 7:46946719-46946741 AAGGGCCCGTAGCAGCCTGGAGG - Intergenic
1024977087 7:55123583-55123605 AATTGCTGGCAGCAGCTTGAGGG + Intronic
1025729231 7:64095506-64095528 CACTGCTGCATGCAGCCTGGAGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034691727 7:153019435-153019457 CACTGCTGGTTGCTGGCTGGAGG - Intergenic
1035548295 8:500749-500771 AGTTGCAGGGAGCAGCCTGGAGG - Intronic
1037747055 8:21654087-21654109 AATTGCTGGGTTCAGCCTGGAGG + Intergenic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1039063751 8:33592243-33592265 GACTGCTTGTGGCAGCTTGGAGG + Intronic
1042718627 8:71803293-71803315 GACTGCAGGTTGCAGCCGGGAGG + Intergenic
1048487430 8:134861656-134861678 TTGTGCTGGTAGCTGCCTGGAGG + Intergenic
1054734253 9:68734515-68734537 GACTGCTGGTAGCAGGCAGATGG + Intronic
1056852444 9:90095840-90095862 AGCTCCTGGTAGAAGCCTGTGGG - Intergenic
1057501115 9:95597356-95597378 AAGTGCTGGAAGCAGGCTTGGGG + Intergenic
1060367640 9:123034510-123034532 AACTGTTGGCAGCAGCCAAGCGG + Exonic
1060883443 9:127134365-127134387 CAGAGCTGGGAGCAGCCTGGAGG + Intronic
1062332340 9:136050280-136050302 ATCTGCTGGAAGCAGGCGGGCGG + Exonic
1187669943 X:21657795-21657817 CAGGGCTGGAAGCAGCCTGGTGG + Exonic
1189470861 X:41313022-41313044 AGCTACTTGTAGCAGTCTGGTGG + Intergenic
1189752209 X:44233834-44233856 ATCTGTTGGCAGCAGCCTGTGGG - Intronic
1190335608 X:49259919-49259941 AGCTGCTGAGAGCAGCCCGGGGG + Intronic
1192543212 X:71992439-71992461 AACTGCAGGGAGCTTCCTGGGGG + Intergenic