ID: 1037884370

View in Genome Browser
Species Human (GRCh38)
Location 8:22588697-22588719
Sequence TCCCCAAAGCTCCACGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037884363_1037884370 5 Left 1037884363 8:22588669-22588691 CCTGAGTGTGGCCCAGGGAGGGC 0: 1
1: 0
2: 4
3: 46
4: 360
Right 1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 179
1037884357_1037884370 25 Left 1037884357 8:22588649-22588671 CCTGGAGACAGGCACTGCTGCCT 0: 1
1: 0
2: 2
3: 47
4: 388
Right 1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 179
1037884366_1037884370 -7 Left 1037884366 8:22588681-22588703 CCAGGGAGGGCTCGGCTCCCCAA 0: 1
1: 0
2: 1
3: 11
4: 158
Right 1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 179
1037884365_1037884370 -6 Left 1037884365 8:22588680-22588702 CCCAGGGAGGGCTCGGCTCCCCA 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037884370 Original CRISPR TCCCCAAAGCTCCACGGGGC AGG Intronic
900370451 1:2329782-2329804 TCCCCAAGGCCCCACTGGGCTGG + Intronic
900592614 1:3466798-3466820 TCCACAAAGCTTCTGGGGGCTGG - Intronic
900830466 1:4961713-4961735 GCCCCAAAGCCCCAAGGGACAGG + Intergenic
901393672 1:8964748-8964770 GCCCCAATGCTCCACGGAGCCGG + Intronic
901757396 1:11449594-11449616 CCCCCAAAGCACCACGGGGGAGG + Intergenic
901880515 1:12191264-12191286 TCTTCACAGCCCCACGGGGCAGG + Intronic
902791225 1:18769522-18769544 ACTCCAAAGTTCCATGGGGCTGG - Intergenic
903214415 1:21835573-21835595 TCCCCCAAGGTCCATGGGCCTGG + Exonic
903335489 1:22621731-22621753 GCCCCACAGCCCCATGGGGCAGG + Intergenic
903917999 1:26778529-26778551 TCCCCACAAGTCCAGGGGGCTGG - Intronic
904029292 1:27523979-27524001 TCCCCAAGGCCCCAAGAGGCAGG - Intergenic
906292133 1:44626209-44626231 TCCCCAAAGCACCACAGGACTGG + Intronic
909741710 1:79037368-79037390 TTCCCACAGCTCCACTAGGCAGG - Intergenic
912641392 1:111349236-111349258 TCCCCAGATCTTCACAGGGCTGG - Intronic
913443295 1:118922486-118922508 TCCTCATAGCTCTACGAGGCAGG + Intronic
916496901 1:165355241-165355263 TCCCCAAAGCCGCGAGGGGCGGG - Intronic
918750366 1:188262554-188262576 TGCCCAAAGCTCCATTGGGGCGG - Intergenic
920313766 1:205063806-205063828 TCCCCAGATCTTCACGCGGCTGG - Intronic
922918517 1:229278943-229278965 TCCCCAAATCTCCACTGTGTTGG + Intronic
922930598 1:229386164-229386186 TACCCAAATCACCACAGGGCCGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1066657866 10:37712173-37712195 TCCCCAAACCTCCATGTGCCTGG + Intergenic
1067042344 10:42961803-42961825 TCCCCAAACCTCCACGTGCCTGG + Intergenic
1068265720 10:54646512-54646534 TTCCTAAAGTTCCAGGGGGCGGG + Intronic
1069270628 10:66522612-66522634 GACCCACAGCTCCACAGGGCTGG - Intronic
1070519835 10:77243075-77243097 TCCCCAAAGCTACATGTGTCAGG + Intronic
1071086596 10:81874435-81874457 TCCCCCACGCTCAACCGGGCAGG + Intergenic
1075464177 10:122639066-122639088 TTCCCACAGCTCCACCAGGCTGG + Intronic
1075934347 10:126326806-126326828 TCCCCAGAACTCCACATGGCAGG + Intronic
1076294597 10:129374742-129374764 GCCCCAAAGCAGCACGGAGCGGG - Intergenic
1077032106 11:473157-473179 TCGGCAAAGCTCCTTGGGGCCGG - Intronic
1077331163 11:1984365-1984387 CACCCCAAGCTCCACTGGGCGGG + Intronic
1077551644 11:3203150-3203172 TCTTCAAAGTTCCCCGGGGCTGG - Intergenic
1079312534 11:19379147-19379169 GCTCCATAGATCCACGGGGCTGG + Intronic
1081845437 11:46237806-46237828 TCCCGACAGCTCCACGCGGTTGG - Intergenic
1084798702 11:71526982-71527004 CCCGCAAAGCTCCAGGGTGCTGG - Intergenic
1085650297 11:78261811-78261833 TTCCCAAAGTTCCTCGGGGGAGG - Intronic
1202814144 11_KI270721v1_random:39541-39563 CACCCCAAGCTCCACTGGGCGGG + Intergenic
1097192639 12:57226801-57226823 CCTGCTAAGCTCCACGGGGCCGG + Intergenic
1104002501 12:124869043-124869065 TAAAAAAAGCTCCACGGGGCAGG + Intronic
1104365242 12:128170794-128170816 TGCCCAAAGCTCTCCCGGGCAGG + Intergenic
1104897254 12:132170522-132170544 TCCCCCAATGTCCCCGGGGCAGG + Intergenic
1106361947 13:29039067-29039089 TCCCCAAGGCTCCTCCTGGCTGG - Intronic
1106435191 13:29717277-29717299 TTCCCAAAGCACCAAAGGGCTGG + Intergenic
1110433868 13:75458051-75458073 ACCCCAACTCTCCACTGGGCTGG - Intronic
1112789559 13:102988045-102988067 TTCCCAAAGCTGCACAGAGCAGG + Intergenic
1121102741 14:91261341-91261363 TCCCCACACCTCCAGAGGGCAGG - Intergenic
1121612535 14:95291475-95291497 TCCCCAGAGCTCCAGGTTGCAGG + Intronic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122577623 14:102752008-102752030 TCACTACAGCCCCACGGGGCAGG - Intergenic
1122974557 14:105165767-105165789 GCCCAAAAGCCCCACGGGCCTGG + Intronic
1123060469 14:105592080-105592102 TCCACATGGCTCCACAGGGCGGG + Intergenic
1123084947 14:105713051-105713073 TCCACATGGCTCCACAGGGCGGG + Intergenic
1123707379 15:22959949-22959971 TCCCCGAATCCCCACGTGGCTGG + Intronic
1128660457 15:69497157-69497179 GCCCCAGAGCTCCACAGTGCTGG - Intergenic
1128685198 15:69679091-69679113 TTCTCAAAGCTCCAGGAGGCAGG + Intergenic
1129669427 15:77598904-77598926 GCCCAGAGGCTCCACGGGGCTGG + Intergenic
1129865220 15:78902321-78902343 CCCCCTAAGCCCCATGGGGCTGG - Intergenic
1132030149 15:98432548-98432570 GACTCAAAGCTCCACGTGGCTGG - Intergenic
1132870201 16:2112459-2112481 TCCCCAAAGGTCCACCTGCCGGG + Exonic
1133223522 16:4329114-4329136 TCCCCGAAGCTCCTCTGTGCTGG - Exonic
1134213955 16:12301436-12301458 CCCCCAAATCTCCACATGGCTGG + Intronic
1134522342 16:14924497-14924519 TCCCCAAAGGTCCACCTGCCGGG - Intronic
1134543886 16:15092987-15093009 TTCCCAAATCTCTACGTGGCTGG + Intronic
1134710012 16:16323148-16323170 TCCCCAAAGGTCCACCTGCCGGG - Intergenic
1134717227 16:16363148-16363170 TCCCCAAAGGTCCACCTGCCGGG - Intergenic
1134949591 16:18345497-18345519 TCCCCAAAGGTCCACCTGCCGGG + Intergenic
1134957524 16:18389011-18389033 TCCCCAAAGGTCCACCTGCCGGG + Intergenic
1135361465 16:21819134-21819156 TTCCCAAATCTCTACGTGGCTGG + Intergenic
1136146012 16:28317202-28317224 TCCCCAAAGCCTCAGGGGCCAGG - Intronic
1136355761 16:29744243-29744265 TCCCCAGAGATCCCCGAGGCAGG - Exonic
1136411646 16:30081145-30081167 TCCTGGAAGCTCCAGGGGGCAGG - Intronic
1136417784 16:30114049-30114071 TCCTCAGAGCCGCACGGGGCAGG + Intergenic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1137612543 16:49828679-49828701 TCCCCAAAGAGCCCCTGGGCGGG + Intronic
1138553841 16:57760989-57761011 TCCCCACAACCCCAAGGGGCAGG - Intronic
1141792267 16:86244732-86244754 CCCCCAAATCTCCACATGGCCGG - Intergenic
1142415095 16:89936811-89936833 GCCCCTCAGCTCCAAGGGGCGGG - Intergenic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1146927446 17:36754736-36754758 GCCACAGAGCTCCACGGAGCAGG - Intergenic
1147931380 17:43983672-43983694 CACCCAACGCTCCCCGGGGCCGG + Intronic
1147948502 17:44093746-44093768 CCCCCGTAGCTCCACAGGGCTGG + Exonic
1148108544 17:45132140-45132162 TTCCCCAGGCTGCACGGGGCTGG - Intronic
1151582717 17:74989155-74989177 TCCACAAGGCTCCAGAGGGCTGG + Intronic
1152516142 17:80826017-80826039 TCCTCAGAGCTCCCCAGGGCCGG - Intronic
1153051702 18:907291-907313 TCCCCAAAGCAGCAACGGGCGGG - Intronic
1154056541 18:11018101-11018123 TACCCAAAGCTGGAAGGGGCAGG - Intronic
1157166001 18:45359043-45359065 TCCCCAAAACTCTAGGTGGCAGG - Intronic
1159264577 18:66063800-66063822 TACCAGAAGCTCCAGGGGGCTGG + Intergenic
1160716066 19:577349-577371 ACCCCAAAGCCCAAAGGGGCAGG - Intronic
1160841882 19:1149996-1150018 TCTCAGAAGCTGCACGGGGCTGG + Intronic
1160873288 19:1286463-1286485 TCCCCCAAACTCCGGGGGGCCGG - Intronic
1161329435 19:3679250-3679272 GCCCCCAAGCTCCAGTGGGCCGG + Intronic
1161444817 19:4312146-4312168 TCCCCAAAGCTCATGGGGTCTGG + Intronic
1161512054 19:4677368-4677390 TCCACAAAGAACCCCGGGGCTGG + Intronic
1162146884 19:8617869-8617891 GCCCCAAAACTGCATGGGGCAGG - Intergenic
1162180400 19:8865156-8865178 TCCCCAAACCACCAAGGGGAGGG - Intronic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1166945184 19:46391872-46391894 TCCACACAGCTCCACGGGAGAGG - Intronic
1167115635 19:47487748-47487770 TCCCCTAAGCTCCAGGGCCCAGG + Exonic
1168259960 19:55187765-55187787 TCCCCAGTGCCCCACAGGGCAGG - Intronic
925901299 2:8511155-8511177 TCCCCACAGCTGCAGGGGGCAGG - Intergenic
926519948 2:13897887-13897909 TTCTCACAGCTCCACTGGGCAGG - Intergenic
932337038 2:70937468-70937490 TCCCCCGAGCTCCATGGGGCAGG - Intronic
933751047 2:85602369-85602391 TCGCCACCGCTCCACTGGGCCGG - Exonic
934640060 2:96022568-96022590 TCCCCATCACTCCACAGGGCTGG - Intronic
934793590 2:97082836-97082858 TCCCCATCACTCCACAGGGCTGG + Intergenic
937082587 2:119151082-119151104 TCCCCAAGGCCCCAAGGGGGAGG + Intergenic
937815433 2:126245259-126245281 TGCCCAAAGCATCACGAGGCAGG + Intergenic
938972860 2:136448278-136448300 TCCCCAGTGCTCCAGGGGGAAGG - Intergenic
942004883 2:171687961-171687983 TCCCCAAAGCTGGGCCGGGCGGG - Intronic
943362028 2:186931408-186931430 TCCCCAAAGTCCCACGTGCCAGG + Intergenic
943571799 2:189582052-189582074 GCCCCAAAGGTCTACGGGGTGGG + Intronic
945001236 2:205353278-205353300 TCCCCAGACCTGCACTGGGCAGG + Intronic
946228376 2:218276906-218276928 GCCCCAAAGGTCCCCGGGGCAGG - Intronic
946985578 2:225268853-225268875 TCCTCAAAGCACCACGTGGATGG + Intergenic
947735005 2:232449794-232449816 TCCCCCTAGGTCCAGGGGGCCGG - Intergenic
947819321 2:233059514-233059536 ACCCCAAAGCCCCACAGGGCAGG - Intergenic
1169399122 20:5264914-5264936 ACCCCAGAGCACCACAGGGCAGG + Intergenic
1170498572 20:16951060-16951082 TCCCCAAGGCTCCAGGTGGAGGG - Intergenic
1173580747 20:44144923-44144945 TCTCCTAGGCCCCACGGGGCAGG + Intronic
1175025126 20:55893879-55893901 TCTCCAAAGCTCTACGGGTGTGG + Intergenic
1175772719 20:61633717-61633739 TCCCCAAAACCCCAAGAGGCAGG - Intronic
1175906209 20:62380847-62380869 TCCCCACACCTCCTGGGGGCTGG - Intergenic
1178628226 21:34236379-34236401 ACCCTAAAGCTCCACAGGGTGGG - Intergenic
1179983192 21:44907080-44907102 TCCCCAGAACTTCACAGGGCCGG - Exonic
1180966270 22:19789443-19789465 ACCCCCAAGCTCGACAGGGCTGG + Intronic
1181311735 22:21948600-21948622 TCCCAGAAGCTCCAGGGGCCAGG - Intronic
1181456574 22:23063399-23063421 GCCTCAAAGCTGCAGGGGGCAGG - Intronic
1181876053 22:25941733-25941755 GCCCAAGACCTCCACGGGGCAGG - Intronic
1182289122 22:29265449-29265471 TCCTCCAAGGTCCACGTGGCTGG + Intronic
1182696598 22:32202950-32202972 TCCAGGAAGCACCACGGGGCTGG + Exonic
1183653847 22:39173925-39173947 TCCCCATCGCTAGACGGGGCAGG - Intergenic
1184697285 22:46147182-46147204 GCCCCACAGCTCCAGGGGGGTGG - Intergenic
1185333606 22:50262032-50262054 TCCCCACGGCTCCAGGGCGCAGG + Intergenic
950315088 3:11995101-11995123 GCCCCAGAGCTCCACAGAGCTGG - Intergenic
950587448 3:13904585-13904607 CCCACAAAGCTCCAGGGGGAGGG + Intergenic
950631007 3:14281992-14282014 TCCCCAAAACTCCACCGGCAAGG - Intergenic
953700813 3:45194371-45194393 TTCCTAAATCTCCATGGGGCAGG - Intergenic
953963427 3:47283658-47283680 ACCACAAAGGTCCCCGGGGCTGG + Intronic
954699853 3:52445510-52445532 TGGCCAAAGCTTCAGGGGGCTGG - Intergenic
954754302 3:52830925-52830947 TCCACCAAGCTCCACAGGGCTGG + Intronic
955199673 3:56839689-56839711 TCCCCAAATCTCAAGGGGTCTGG + Intronic
961624568 3:128252994-128253016 TCCCCAGGGCTCCATGGAGCTGG + Intronic
967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG + Intergenic
968648025 4:1749517-1749539 TCCACAAACCTCCAGGGGTCTGG - Intergenic
968753034 4:2400066-2400088 TCCCCGGAGCTCCTCAGGGCGGG + Intronic
968959163 4:3734312-3734334 TCCCGAGATCTCCACTGGGCAGG + Intergenic
969564158 4:7967811-7967833 TCCCCACAGCTCCAGGGTGTGGG - Intronic
969638320 4:8382172-8382194 TCCACAAAGCTCAAAAGGGCAGG + Intronic
973796067 4:54427897-54427919 TCCCTAAAGTTCCATGGGGGTGG - Intergenic
978859694 4:113433464-113433486 TCCCCAAATCTCCACATGGAAGG + Intergenic
982832817 4:160085591-160085613 TCCCAAAATCTCCACGTGTCCGG - Intergenic
984056254 4:174932928-174932950 TCCCCAAATCTCCTAGGGCCAGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
988925864 5:35990779-35990801 CACCCTAAGCTCCATGGGGCCGG - Intronic
997596970 5:135113499-135113521 AGCCCAAAGCACCATGGGGCAGG - Intronic
997856674 5:137378960-137378982 TTCCCAGGGCTCCACGGGGTTGG + Intronic
999150866 5:149424974-149424996 TCCACAAAGCTCCATGGGAAGGG - Intergenic
999696175 5:154190441-154190463 TTCGCAAAGCTCCAGAGGGCGGG + Intronic
1000668379 5:164027561-164027583 TTCCCAAATGTCCACTGGGCTGG + Intergenic
1002091176 5:176807400-176807422 TCCCCAGATCTTCACGTGGCTGG - Intergenic
1003007122 6:2392415-2392437 CCCAGAAAGCTCCACGGGGGAGG + Intergenic
1004553011 6:16667934-16667956 TCCCCAAAGTGCCTCGGGCCAGG + Intronic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1009929483 6:70160169-70160191 GACCCACAGCTCCACGTGGCTGG + Intronic
1010126814 6:72442132-72442154 TCCCCAGAGCTGCAGGGGGAAGG - Intergenic
1018176708 6:161183830-161183852 TCCCCAGAGAGCCACGAGGCTGG - Intronic
1019539729 7:1546264-1546286 TTCCCACAGCCCCACGGTGCTGG + Exonic
1019924365 7:4182457-4182479 TTCCCAAACTTCCACAGGGCAGG + Intronic
1022473726 7:30697307-30697329 TGTCCAAAGCTCCAAGGAGCTGG + Intronic
1024197575 7:47074024-47074046 TCCCCAAAGCTGCCCAGGTCAGG - Intergenic
1029585648 7:101469112-101469134 TCCCCAGGGCCCCACGAGGCAGG - Intronic
1033355983 7:140600665-140600687 TTCCCAAAGCTCAATGGGGTGGG + Intronic
1035282892 7:157788507-157788529 TCCACAGGCCTCCACGGGGCTGG + Intronic
1035903254 8:3480330-3480352 TCTCCATTGCTCCAGGGGGCTGG - Intronic
1036789001 8:11705179-11705201 TTCCCCAACCTCCACGGTGCGGG - Intronic
1037399483 8:18479576-18479598 TCCCCCAACCTCCAAAGGGCAGG - Intergenic
1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG + Intronic
1037914041 8:22761210-22761232 ACCCCACAGTTCCCCGGGGCAGG - Intronic
1038070828 8:24010896-24010918 TCCCCAAGGCTCCAGTGGACAGG - Intergenic
1039155688 8:34554171-34554193 ACCTCAAGGCTCCACTGGGCAGG - Intergenic
1041118107 8:54560204-54560226 TCCCCAAAACTCCTGGGGGATGG - Intergenic
1045849314 8:106674048-106674070 TTCTCACAGCTCCACTGGGCAGG - Intronic
1049165320 8:141122054-141122076 TCCCCAGAGCTGCACAGAGCAGG - Intronic
1060114481 9:120929234-120929256 TCCCCAGACCGCCGCGGGGCGGG + Intergenic
1060187386 9:121572016-121572038 TTCACACAGCTCCAAGGGGCTGG - Intronic
1060239885 9:121893952-121893974 CCTCCAAAGCTCTAAGGGGCTGG + Intronic
1061500162 9:130997416-130997438 GCCCCAAAGCTCCAGGCTGCAGG + Intergenic
1062581930 9:137232568-137232590 TCCTCAGAGCTCCGCGTGGCCGG + Exonic
1187448197 X:19375680-19375702 TCCTCAGAGCTCCTGGGGGCTGG + Intronic
1197513160 X:127396111-127396133 TGCCCAAAGCCCCACTGGGGCGG + Intergenic