ID: 1037885919

View in Genome Browser
Species Human (GRCh38)
Location 8:22596309-22596331
Sequence AGCCAGAGGGGGATTTGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037885919_1037885926 14 Left 1037885919 8:22596309-22596331 CCAGCTCAAATCCCCCTCTGGCT 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1037885926 8:22596346-22596368 TGGCAGCCATCTCTCCTCCCAGG 0: 1
1: 0
2: 5
3: 44
4: 357
1037885919_1037885931 25 Left 1037885919 8:22596309-22596331 CCAGCTCAAATCCCCCTCTGGCT 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG 0: 1
1: 0
2: 5
3: 26
4: 297
1037885919_1037885925 -6 Left 1037885919 8:22596309-22596331 CCAGCTCAAATCCCCCTCTGGCT 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1037885925 8:22596326-22596348 CTGGCTCTTGTTCTTTGGTGTGG 0: 1
1: 0
2: 2
3: 17
4: 216
1037885919_1037885930 24 Left 1037885919 8:22596309-22596331 CCAGCTCAAATCCCCCTCTGGCT 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1037885930 8:22596356-22596378 CTCTCCTCCCAGGGGTCCTGAGG 0: 1
1: 0
2: 3
3: 46
4: 443
1037885919_1037885928 16 Left 1037885919 8:22596309-22596331 CCAGCTCAAATCCCCCTCTGGCT 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1037885928 8:22596348-22596370 GCAGCCATCTCTCCTCCCAGGGG 0: 1
1: 0
2: 2
3: 34
4: 331
1037885919_1037885927 15 Left 1037885919 8:22596309-22596331 CCAGCTCAAATCCCCCTCTGGCT 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1037885927 8:22596347-22596369 GGCAGCCATCTCTCCTCCCAGGG 0: 1
1: 1
2: 2
3: 31
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037885919 Original CRISPR AGCCAGAGGGGGATTTGAGC TGG (reversed) Intronic