ID: 1037885924

View in Genome Browser
Species Human (GRCh38)
Location 8:22596323-22596345
Sequence CACCAAAGAACAAGAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 236}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037885924_1037885931 11 Left 1037885924 8:22596323-22596345 CCTCTGGCTCTTGTTCTTTGGTG 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG 0: 1
1: 0
2: 5
3: 26
4: 297
1037885924_1037885928 2 Left 1037885924 8:22596323-22596345 CCTCTGGCTCTTGTTCTTTGGTG 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1037885928 8:22596348-22596370 GCAGCCATCTCTCCTCCCAGGGG 0: 1
1: 0
2: 2
3: 34
4: 331
1037885924_1037885926 0 Left 1037885924 8:22596323-22596345 CCTCTGGCTCTTGTTCTTTGGTG 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1037885926 8:22596346-22596368 TGGCAGCCATCTCTCCTCCCAGG 0: 1
1: 0
2: 5
3: 44
4: 357
1037885924_1037885930 10 Left 1037885924 8:22596323-22596345 CCTCTGGCTCTTGTTCTTTGGTG 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1037885930 8:22596356-22596378 CTCTCCTCCCAGGGGTCCTGAGG 0: 1
1: 0
2: 3
3: 46
4: 443
1037885924_1037885935 24 Left 1037885924 8:22596323-22596345 CCTCTGGCTCTTGTTCTTTGGTG 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1037885935 8:22596370-22596392 GTCCTGAGGGTTTCAGCACCAGG 0: 1
1: 0
2: 1
3: 19
4: 148
1037885924_1037885927 1 Left 1037885924 8:22596323-22596345 CCTCTGGCTCTTGTTCTTTGGTG 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1037885927 8:22596347-22596369 GGCAGCCATCTCTCCTCCCAGGG 0: 1
1: 1
2: 2
3: 31
4: 281
1037885924_1037885936 25 Left 1037885924 8:22596323-22596345 CCTCTGGCTCTTGTTCTTTGGTG 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1037885936 8:22596371-22596393 TCCTGAGGGTTTCAGCACCAGGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037885924 Original CRISPR CACCAAAGAACAAGAGCCAG AGG (reversed) Intronic