ID: 1037885931

View in Genome Browser
Species Human (GRCh38)
Location 8:22596357-22596379
Sequence TCTCCTCCCAGGGGTCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037885924_1037885931 11 Left 1037885924 8:22596323-22596345 CCTCTGGCTCTTGTTCTTTGGTG 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG 0: 1
1: 0
2: 5
3: 26
4: 297
1037885923_1037885931 12 Left 1037885923 8:22596322-22596344 CCCTCTGGCTCTTGTTCTTTGGT 0: 1
1: 0
2: 3
3: 26
4: 347
Right 1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG 0: 1
1: 0
2: 5
3: 26
4: 297
1037885919_1037885931 25 Left 1037885919 8:22596309-22596331 CCAGCTCAAATCCCCCTCTGGCT 0: 1
1: 0
2: 1
3: 22
4: 255
Right 1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG 0: 1
1: 0
2: 5
3: 26
4: 297
1037885921_1037885931 13 Left 1037885921 8:22596321-22596343 CCCCTCTGGCTCTTGTTCTTTGG 0: 1
1: 0
2: 0
3: 33
4: 338
Right 1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG 0: 1
1: 0
2: 5
3: 26
4: 297
1037885920_1037885931 14 Left 1037885920 8:22596320-22596342 CCCCCTCTGGCTCTTGTTCTTTG 0: 1
1: 0
2: 4
3: 59
4: 592
Right 1037885931 8:22596357-22596379 TCTCCTCCCAGGGGTCCTGAGGG 0: 1
1: 0
2: 5
3: 26
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037885931 Original CRISPR TCTCCTCCCAGGGGTCCTGA GGG Intronic