ID: 1037886040

View in Genome Browser
Species Human (GRCh38)
Location 8:22597007-22597029
Sequence TCACCTCTGGTCACAACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037886032_1037886040 17 Left 1037886032 8:22596967-22596989 CCCTCTGTCATCAGAGGCAGCCT 0: 1
1: 0
2: 2
3: 35
4: 252
Right 1037886040 8:22597007-22597029 TCACCTCTGGTCACAACTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1037886036_1037886040 -3 Left 1037886036 8:22596987-22597009 CCTTCCAGGCACAGCTCTGGTCA 0: 1
1: 0
2: 4
3: 24
4: 301
Right 1037886040 8:22597007-22597029 TCACCTCTGGTCACAACTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1037886037_1037886040 -7 Left 1037886037 8:22596991-22597013 CCAGGCACAGCTCTGGTCACCTC 0: 1
1: 0
2: 4
3: 42
4: 352
Right 1037886040 8:22597007-22597029 TCACCTCTGGTCACAACTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1037886033_1037886040 16 Left 1037886033 8:22596968-22596990 CCTCTGTCATCAGAGGCAGCCTT 0: 1
1: 0
2: 3
3: 36
4: 274
Right 1037886040 8:22597007-22597029 TCACCTCTGGTCACAACTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037886040 Original CRISPR TCACCTCTGGTCACAACTGG AGG Intronic
902082734 1:13832430-13832452 TCCCCTGAGGTCACAAATGGTGG + Intergenic
902903454 1:19536351-19536373 ACACCTGTGGTCACAACTACTGG + Intergenic
903156941 1:21451873-21451895 TCACATTTGATCCCAACTGGCGG - Intronic
904586512 1:31583918-31583940 TGCCCTCTGGCCAGAACTGGAGG - Intronic
908042461 1:60129295-60129317 TCACCACTGCACACAACTTGAGG - Intergenic
913541866 1:119828916-119828938 TCACATTTGATCCCAACTGGCGG - Intergenic
913545315 1:119862024-119862046 TCACATTTGATCCCAACTGGCGG + Intergenic
913601743 1:120427811-120427833 TCACATTTGATCCCAACTGGCGG - Intergenic
914085299 1:144448789-144448811 TCACATTTGATCCCAACTGGCGG + Exonic
914191188 1:145412763-145412785 TCACATTTGATCCCAACTGGCGG + Intergenic
914589120 1:149090767-149090789 TCACATTTGATCCCAACTGGCGG + Exonic
918202350 1:182279311-182279333 TCAGCTCTGGTGTCTACTGGTGG - Intergenic
918322661 1:183379305-183379327 ACACCTATGGTCCCAACTGCTGG - Intronic
920361950 1:205424810-205424832 TCACCTCTGGGCACACGTAGAGG + Intronic
920891913 1:209995251-209995273 TCACCTCTTGTGACACCTGTAGG + Intronic
922697439 1:227737964-227737986 TCATCTCTGGACGGAACTGGAGG - Intronic
1062929539 10:1343824-1343846 GCACCTATGGCCACAAATGGGGG + Intronic
1063096931 10:2916303-2916325 ACACCTCTGGGCTCCACTGGGGG - Intergenic
1066106764 10:32163525-32163547 TCCCCTGTGGTCACAGGTGGAGG + Intergenic
1067056667 10:43056607-43056629 CCCCCTCTGTGCACAACTGGTGG + Intergenic
1073504976 10:103977486-103977508 TCACCTGTGGTCACAGCTGCTGG + Intronic
1075586835 10:123664820-123664842 TCACCACTGGCCACACCAGGAGG + Intergenic
1083459242 11:62799739-62799761 CCAGCTCTGGTCACATCTTGGGG + Intronic
1087940019 11:104085243-104085265 TAACCTCTGGTAACCACTGATGG + Intronic
1089505060 11:118957191-118957213 TCACCACTGGGCAGAAGTGGCGG - Exonic
1089526033 11:119097294-119097316 TCACCTCTGGTCCCTCCAGGTGG - Exonic
1091207211 11:133830066-133830088 CCATCTCTGGGCAGAACTGGTGG - Intergenic
1094363092 12:29651095-29651117 TCACCTCTGCTCAGACCTGGAGG - Intronic
1094405921 12:30116053-30116075 TCACCTCTGTACTCAGCTGGAGG + Intergenic
1100234014 12:92639413-92639435 TCACTTTTTGTCACAACTTGAGG + Intergenic
1101818306 12:108162748-108162770 TGACCTCTGCTCAGACCTGGAGG + Intronic
1101860304 12:108477108-108477130 TCAGCTCTGGTCACAAGGAGAGG + Intergenic
1103664558 12:122552649-122552671 TCACTCCTGGCCACAAGTGGTGG - Intronic
1106482746 13:30149071-30149093 TCACCACTGGTGACAAATGCTGG - Intergenic
1108712421 13:53046691-53046713 TCACATCATGTTACAACTGGAGG - Intronic
1108766141 13:53631666-53631688 TCACCTCAAGGCACAACAGGGGG + Intergenic
1113484653 13:110645349-110645371 CCACCTCTGGAAACACCTGGGGG - Intronic
1113583602 13:111447803-111447825 TCACCTCTGTGCTCAACTTGCGG + Intergenic
1114291888 14:21295285-21295307 CCTCCCCTGGTCACAACTGAGGG + Intronic
1115643018 14:35347438-35347460 TGACCTCTGGTCACGCCTGTGGG - Intergenic
1116576359 14:46581254-46581276 TCTCTTCTTGTCACCACTGGAGG + Intergenic
1122552314 14:102556615-102556637 TCCCCACTGGTCAGAACTGCAGG - Intergenic
1122723883 14:103737802-103737824 TCACCTCTGCAAACAGCTGGTGG - Exonic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128062487 15:64743625-64743647 CCCCCCCTGGGCACAACTGGAGG - Intronic
1128858601 15:71044657-71044679 ACGCCTGTGGTCACAACTGCTGG + Intronic
1128867384 15:71124914-71124936 GCACCTGTGGTCCCAGCTGGTGG + Intronic
1129892431 15:79080278-79080300 TCATCTCTGGTCACATCTGCAGG - Intronic
1131261903 15:90891948-90891970 CCACCCCTGGTCACATATGGAGG + Intronic
1133788267 16:8989580-8989602 TCACAGCTGGTCACAACTCCTGG - Intergenic
1134017180 16:10896976-10896998 TCACATTTCCTCACAACTGGAGG + Intronic
1142930318 17:3278787-3278809 GCCTATCTGGTCACAACTGGGGG - Exonic
1142945188 17:3420694-3420716 GCCTATCTGGTCACAACTGGGGG + Exonic
1148048283 17:44757392-44757414 TCCCCTCTGGTCCCAAATGGAGG + Intergenic
1152063242 17:78095003-78095025 TCCCCGCTTGTCACACCTGGTGG + Intronic
1153624583 18:7012012-7012034 CCACCTCTGCTCAGAGCTGGAGG - Exonic
1158839751 18:61372519-61372541 TGACCTCTGGTCAGAATTAGAGG - Intronic
1162041022 19:7971190-7971212 TCACCTCTGCACACAGCTGCTGG - Intronic
1166532260 19:43550095-43550117 TCCCCTCTGCTCACAAGAGGAGG + Intronic
928235437 2:29535330-29535352 TTACCTCTGGTCACCAGTGTAGG + Intronic
928471780 2:31582126-31582148 TCTCCTCTGGTCCCTACTTGGGG + Intergenic
930909436 2:56613456-56613478 ACAACTGTGGTTACAACTGGAGG - Intergenic
932427102 2:71645036-71645058 TCACCTCTGGACACTGCTGTGGG - Intronic
932932159 2:76054335-76054357 TCACCTGTATTCACAACTAGTGG - Intergenic
934124944 2:88879242-88879264 TGGCCTCTGGTCAGAACTTGGGG + Intergenic
937093687 2:119223006-119223028 TCACCTGTGGTCACATTTGCCGG - Intergenic
938770596 2:134497951-134497973 TCACCTCTGGCCACTATTTGGGG + Intronic
947426349 2:229986374-229986396 TCACCTGTGGTCCCATCTGCTGG + Intronic
948555204 2:238804801-238804823 TCACATCTGGGGACAATTGGGGG + Intergenic
1173224261 20:41152788-41152810 TCACCACTTGTCACACCTGCTGG - Intronic
1175596690 20:60240251-60240273 TCACCTCTGATCAGAGTTGGGGG + Intergenic
1184511703 22:44937362-44937384 GCACCTGTGTTCACACCTGGTGG - Intronic
1184981515 22:48099154-48099176 TGTCCTCTGATCACACCTGGGGG - Intergenic
954437827 3:50505199-50505221 CCACCTCTGGACACAATGGGAGG + Intergenic
954874852 3:53795325-53795347 TCACCTATAGTCACGACTGTGGG - Intronic
960450596 3:117802088-117802110 TCACCTGTCATCACACCTGGAGG - Intergenic
961017742 3:123480625-123480647 GCACCTCTGGGCCCCACTGGGGG + Intergenic
961043663 3:123694477-123694499 TGACCTCTGGCCCCAACTAGAGG + Intronic
962682485 3:137814814-137814836 TGGCCTCTGGTCAGAGCTGGAGG - Intergenic
971148458 4:24005603-24005625 TCATTTCTAGACACAACTGGAGG + Intergenic
976206694 4:82629175-82629197 CCACCTCTGGTAACTATTGGTGG + Intergenic
984248209 4:177300856-177300878 TGACATTTGGTCACAACTAGGGG - Intergenic
985671352 5:1208616-1208638 TCAGCTCTGTTCCCAAGTGGTGG + Intronic
988141862 5:27253546-27253568 TCACATTTATTCACAACTGGAGG - Intergenic
988451098 5:31343855-31343877 TCTACTCTGGGCACAAGTGGTGG - Intergenic
1007462108 6:42026412-42026434 TCCCCTCTGGTCAAAGGTGGAGG - Intronic
1008429892 6:51403454-51403476 TGACCTCTGGTCACAAATTCAGG + Intergenic
1012940547 6:105410204-105410226 GCACATCTGGTCACACCTGGAGG + Intergenic
1014127402 6:117792789-117792811 TAACCTCTGCTCCCATCTGGTGG - Intergenic
1036165577 8:6429669-6429691 TGACCTCTGGTTAAATCTGGTGG - Intronic
1037886040 8:22597007-22597029 TCACCTCTGGTCACAACTGGAGG + Intronic
1038761760 8:30391052-30391074 TCACCTGTGCTCGCAAATGGAGG - Intronic
1038761773 8:30391138-30391160 TCACCTGTGCTCGCAAATGGAGG - Intronic
1045438291 8:102186109-102186131 TCACCTGTGTTCTCAACTGCAGG + Intergenic
1049313315 8:141945408-141945430 TCACCTCTGCTCACCACGGCAGG - Intergenic
1050573935 9:6972532-6972554 TAACCTATGACCACAACTGGTGG - Intronic
1051896446 9:21994372-21994394 TCACCTCTGGTGCCAAAGGGCGG - Intronic
1055186496 9:73462138-73462160 ACATCTATGGTCACAACTGCTGG - Intergenic
1060772094 9:126339534-126339556 TCTCCTCTGGTCACATCAAGAGG + Intronic
1061912001 9:133729888-133729910 TCAGCTCTGCTGACACCTGGTGG + Intronic
1186641676 X:11462261-11462283 TCAGCTCAGGTCACAACTTGTGG - Intronic
1199904858 X:152215186-152215208 TCACCACTTCTCACAACTAGTGG - Intronic
1199969249 X:152846755-152846777 ACACCTCTGGTAGTAACTGGTGG + Intronic
1200087257 X:153613329-153613351 CCATCTCTGGTCACAACAGCTGG - Intergenic
1201958258 Y:19649717-19649739 TCTCCTCTGTTCCCAACTGAGGG - Intergenic