ID: 1037886844

View in Genome Browser
Species Human (GRCh38)
Location 8:22599894-22599916
Sequence CTCCCTCGCCGCCTCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 337}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037886829_1037886844 20 Left 1037886829 8:22599851-22599873 CCCAGCCCCGCGCACCCCGCGGG 0: 1
1: 0
2: 1
3: 38
4: 360
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886833_1037886844 15 Left 1037886833 8:22599856-22599878 CCCCGCGCACCCCGCGGGCGGAG 0: 1
1: 0
2: 1
3: 16
4: 158
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886834_1037886844 14 Left 1037886834 8:22599857-22599879 CCCGCGCACCCCGCGGGCGGAGC 0: 1
1: 0
2: 1
3: 22
4: 150
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886831_1037886844 19 Left 1037886831 8:22599852-22599874 CCAGCCCCGCGCACCCCGCGGGC 0: 1
1: 0
2: 3
3: 77
4: 592
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886838_1037886844 4 Left 1037886838 8:22599867-22599889 CCGCGGGCGGAGCCCGCGCCGCT 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886840_1037886844 -9 Left 1037886840 8:22599880-22599902 CCGCGCCGCTGCGCCTCCCTCGC 0: 1
1: 0
2: 2
3: 41
4: 379
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886835_1037886844 13 Left 1037886835 8:22599858-22599880 CCGCGCACCCCGCGGGCGGAGCC 0: 1
1: 0
2: 3
3: 25
4: 206
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886836_1037886844 6 Left 1037886836 8:22599865-22599887 CCCCGCGGGCGGAGCCCGCGCCG 0: 1
1: 0
2: 1
3: 26
4: 209
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886839_1037886844 -8 Left 1037886839 8:22599879-22599901 CCCGCGCCGCTGCGCCTCCCTCG 0: 1
1: 0
2: 5
3: 26
4: 247
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886837_1037886844 5 Left 1037886837 8:22599866-22599888 CCCGCGGGCGGAGCCCGCGCCGC 0: 1
1: 0
2: 1
3: 42
4: 277
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037886844 Original CRISPR CTCCCTCGCCGCCTCCCTGG AGG Intronic