ID: 1037886844

View in Genome Browser
Species Human (GRCh38)
Location 8:22599894-22599916
Sequence CTCCCTCGCCGCCTCCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 337}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037886829_1037886844 20 Left 1037886829 8:22599851-22599873 CCCAGCCCCGCGCACCCCGCGGG 0: 1
1: 0
2: 1
3: 38
4: 360
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886834_1037886844 14 Left 1037886834 8:22599857-22599879 CCCGCGCACCCCGCGGGCGGAGC 0: 1
1: 0
2: 1
3: 22
4: 150
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886839_1037886844 -8 Left 1037886839 8:22599879-22599901 CCCGCGCCGCTGCGCCTCCCTCG 0: 1
1: 0
2: 5
3: 26
4: 247
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886835_1037886844 13 Left 1037886835 8:22599858-22599880 CCGCGCACCCCGCGGGCGGAGCC 0: 1
1: 0
2: 3
3: 25
4: 206
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886833_1037886844 15 Left 1037886833 8:22599856-22599878 CCCCGCGCACCCCGCGGGCGGAG 0: 1
1: 0
2: 1
3: 16
4: 158
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886836_1037886844 6 Left 1037886836 8:22599865-22599887 CCCCGCGGGCGGAGCCCGCGCCG 0: 1
1: 0
2: 1
3: 26
4: 209
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886831_1037886844 19 Left 1037886831 8:22599852-22599874 CCAGCCCCGCGCACCCCGCGGGC 0: 1
1: 0
2: 3
3: 77
4: 592
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886837_1037886844 5 Left 1037886837 8:22599866-22599888 CCCGCGGGCGGAGCCCGCGCCGC 0: 1
1: 0
2: 1
3: 42
4: 277
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886840_1037886844 -9 Left 1037886840 8:22599880-22599902 CCGCGCCGCTGCGCCTCCCTCGC 0: 1
1: 0
2: 2
3: 41
4: 379
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337
1037886838_1037886844 4 Left 1037886838 8:22599867-22599889 CCGCGGGCGGAGCCCGCGCCGCT 0: 1
1: 0
2: 2
3: 15
4: 169
Right 1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG 0: 1
1: 0
2: 2
3: 40
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037886844 Original CRISPR CTCCCTCGCCGCCTCCCTGG AGG Intronic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
900325720 1:2107843-2107865 CTCCCTCGACACTGCCCTGGGGG - Intronic
900412471 1:2519035-2519057 CACCCTCCAGGCCTCCCTGGGGG + Intronic
900432452 1:2609305-2609327 CTGCCTCGGCCCCTTCCTGGCGG + Intronic
900543037 1:3213536-3213558 GTCCTTTGTCGCCTCCCTGGGGG + Intronic
900786866 1:4655037-4655059 CTCCCTCCTCGCCGCCCCGGAGG + Exonic
901931032 1:12596178-12596200 AGCCCTCGCCGCCCCTCTGGCGG + Intronic
902513136 1:16976824-16976846 CTCCCTCTACCCCTCCCAGGGGG + Intronic
902612986 1:17608025-17608047 CTCCCTCCCTCCCTCCCTGAAGG - Intronic
902809126 1:18878347-18878369 CTCCTTCCCTGCCTCCCTGAGGG - Intronic
903028169 1:20444311-20444333 ATCCCTTCCCTCCTCCCTGGAGG + Intergenic
903280805 1:22248882-22248904 CTGCCTTGCAGCCTCCCAGGCGG + Intergenic
903614772 1:24643613-24643635 CTCGCTGCCCGCCTGCCTGGCGG + Intronic
904086665 1:27914277-27914299 CTTCCTCGCCGCCTTCCTGCGGG + Intronic
904413742 1:30342361-30342383 CTCCTTCCCCGGCTCCCTTGGGG + Intergenic
904607126 1:31704104-31704126 CTCCTCCTCCTCCTCCCTGGCGG - Exonic
904837758 1:33349931-33349953 CTCCCTCGCCCCGCCCCCGGCGG - Intronic
905632704 1:39527503-39527525 CTCCCCAGGCCCCTCCCTGGGGG - Intergenic
905734607 1:40316756-40316778 CGCCCCCGCCGCCTCCCAGGGGG - Intronic
905945519 1:41898312-41898334 CTTCCTGGCAGTCTCCCTGGAGG + Intronic
907444938 1:54501475-54501497 CTCCCCCGACTCCTCACTGGAGG + Intergenic
907767185 1:57423492-57423514 CTCCCTCCCTCCCTCGCTGGTGG - Intronic
908842665 1:68294963-68294985 CTGCCTCTATGCCTCCCTGGAGG - Intergenic
910374461 1:86553285-86553307 CTCCCTCCACGTCTTCCTGGTGG + Intronic
912084529 1:105982257-105982279 CTCCCATGCGGCCTGCCTGGGGG + Intergenic
912433764 1:109644024-109644046 TTCCCTCGCCGCTCCTCTGGAGG + Intergenic
913195854 1:116455372-116455394 CTCCCTCTCCACCTCCGTGCTGG + Intergenic
913994214 1:143638868-143638890 CCCCCCCGCCGCCTCCCTCCCGG - Intergenic
915195099 1:154183272-154183294 CTGCCTTCCCGCCTGCCTGGCGG - Intronic
915279572 1:154813442-154813464 CTCCCACGCCTCCTCCCCTGCGG - Intronic
916069088 1:161159652-161159674 CTCTCCCGCCGCCTCACTGGGGG + Exonic
916961476 1:169893787-169893809 CTCCCCCGCCGCCTTCCTGCAGG - Exonic
917846690 1:179026015-179026037 CGCCCCCGCCGCCTCCGGGGAGG - Exonic
918239894 1:182611872-182611894 CTCCCCCGCCGCCACTCTGCCGG - Intergenic
919670460 1:200333010-200333032 CTCTCTCTCCCCCTCCCTGGAGG - Intergenic
919810138 1:201404145-201404167 CTCTCTCGTCCCCTCCCTCGAGG + Intronic
919854708 1:201697310-201697332 CTGCCTGGCTGCCTCCCTGGAGG - Intronic
921142369 1:212320637-212320659 CTCCCTCCCCGCCTCCCTCCCGG + Intronic
922364926 1:224854575-224854597 CTCACTCTCTACCTCCCTGGGGG - Intergenic
923030498 1:230245840-230245862 CTCCCTCCCTGCCTCCCAGCAGG + Intronic
924437388 1:244054383-244054405 CTGCCTCTCCGCCAGCCTGGGGG - Exonic
924527279 1:244863750-244863772 CTTCCCCGCGGCCTCCTTGGCGG + Exonic
924740652 1:246792748-246792770 AGCCCTCGCGGCCGCCCTGGGGG + Intergenic
1063614429 10:7589866-7589888 CTTCCCCGGCTCCTCCCTGGAGG + Intronic
1063971067 10:11381499-11381521 CTCCCTGTCCCCCTCCCTCGTGG - Intergenic
1065487614 10:26249912-26249934 CTCCTTCTCCGCCCTCCTGGTGG - Intronic
1066135978 10:32446486-32446508 CTGCCTGGCTGCCTCCGTGGCGG + Exonic
1067660521 10:48233700-48233722 CTGCCTCCCCTCCTCCTTGGAGG + Intronic
1067662857 10:48249547-48249569 CTCCCTCTTCCCCACCCTGGAGG - Intronic
1070162899 10:73876408-73876430 CTCCCAAGCTGCCTCCCTGAGGG + Intergenic
1071451099 10:85791981-85792003 CTCCCTGGCCTCCTGCCTGGGGG - Intronic
1071628648 10:87199288-87199310 CTCCCTCCCCAGCTCACTGGAGG - Intergenic
1072913474 10:99523001-99523023 CTCGCTCGCCTCCTCCTGGGCGG - Intergenic
1073056581 10:100707051-100707073 TTCCCGAGCCGTCTCCCTGGCGG + Intergenic
1073325567 10:102642662-102642684 CTCCGCCGCCGCCTTCCTCGCGG + Intergenic
1075369976 10:121927760-121927782 CCCCCTCGCGTCCTCGCTGGGGG + Intronic
1076781589 10:132727687-132727709 CTCACCCTCAGCCTCCCTGGTGG + Intronic
1077251491 11:1562833-1562855 CTCCCTCCCCACCTCTCTGTGGG - Intronic
1077302003 11:1851771-1851793 TCCCCACGCCTCCTCCCTGGGGG - Intergenic
1077550077 11:3196344-3196366 CCCCCTCTCCTCCTCTCTGGAGG + Intergenic
1081720727 11:45286315-45286337 CTCCGTCCCCGCCCCTCTGGCGG - Exonic
1081853959 11:46292208-46292230 TTCCCTCGGCTCCTCCCTAGTGG - Intronic
1083228769 11:61301748-61301770 GGCCCTCCCCGCCCCCCTGGAGG - Intronic
1083599662 11:63939034-63939056 CGCCGTTGCCGCCTCCCTGCCGG + Exonic
1084045972 11:66568040-66568062 CTCCCTGGAGGCCACCCTGGAGG - Exonic
1084113062 11:67025784-67025806 CTCCCTCTCCTCCTCCGTGGAGG + Intronic
1084756008 11:71239107-71239129 CTCCCTCTTGGCCTGCCTGGCGG - Intronic
1084955902 11:72691420-72691442 TTCCCTGGCCGCCTCCCTCTAGG - Intronic
1085784933 11:79440527-79440549 CGTCCTCGCCGCTTCCCCGGCGG - Exonic
1087939009 11:104071028-104071050 CTCCCTCACTGCCTCACTAGGGG + Intronic
1088223145 11:107590921-107590943 CTCCCGGGTGGCCTCCCTGGAGG - Intergenic
1089397704 11:118146412-118146434 CTGCCTCACCTCCTCCCTAGAGG + Intronic
1089814737 11:121162294-121162316 CTCCCTGGCCGCCTACGGGGAGG + Exonic
1090202842 11:124868437-124868459 CTCCCTCGCCTCCTGCCCAGTGG - Intronic
1090636890 11:128694938-128694960 CGGCCTCGCCGCCTCTCCGGCGG + Intronic
1091232838 11:133999636-133999658 CTCCCTCTCCGACTCCTGGGAGG - Intergenic
1091732546 12:2891368-2891390 CACCCGCACCGCCTCCCGGGAGG - Intronic
1092233699 12:6792538-6792560 TTCCCTCCCCTCCTCCCTTGAGG + Intronic
1092537505 12:9403278-9403300 CTCAGTCCCCGCCTCGCTGGGGG - Intergenic
1092557321 12:9570497-9570519 CTCAGTCCCCGCCTCGCTGGGGG + Intergenic
1094303870 12:28995977-28995999 CTCCCTTTCAGCCTCCCTGGGGG + Intergenic
1094515035 12:31120972-31120994 CTCACTCCCCGCCTCGCGGGGGG - Intergenic
1097021130 12:56021512-56021534 CTCCCTCGCCGTTTCCAAGGCGG + Exonic
1101253720 12:102957714-102957736 CTCCCTGGCCGGATCCCTGTCGG - Exonic
1102302931 12:111783913-111783935 CTCCCTCGGCCCCTCCATGGTGG + Intronic
1102518228 12:113464161-113464183 CTCCCTCGCTGCCGCCCCCGGGG - Intronic
1102587307 12:113932470-113932492 CTCCCTCTCCTTCTCCCTGCAGG + Intronic
1104893574 12:132151484-132151506 CCACCTCCCCGCCTACCTGGTGG + Exonic
1104982650 12:132581192-132581214 CTCCCTCCCTGCCCCCCTTGGGG + Intronic
1106539966 13:30681690-30681712 CTCCCTCACCAGCTCCCTGGAGG - Intergenic
1106956310 13:34942625-34942647 ATCCCCCGCCGCCTCCGCGGGGG + Exonic
1107749249 13:43546550-43546572 CTCCTTTGCCGCCTCACTGTCGG + Intronic
1107951345 13:45465020-45465042 CGCCATCGCCGCCGCCCTCGCGG - Exonic
1109538230 13:63741926-63741948 CTCAGTCGCCGCCTCGCGGGGGG + Intergenic
1112444397 13:99450983-99451005 CTCTCTTCCCTCCTCCCTGGAGG + Intergenic
1112498752 13:99926221-99926243 TTCACTCCCCGCCTCCCTGTCGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1114516301 14:23302144-23302166 TGCCCCCGCCGCCTACCTGGAGG + Exonic
1114568081 14:23647073-23647095 TTCCCTGGCCCCCTCCCTGAAGG + Intergenic
1116942611 14:50805392-50805414 CTCCCTCTCAGGCTCACTGGGGG + Intronic
1118303612 14:64636401-64636423 CTCTCTCACGGTCTCCCTGGAGG + Intergenic
1118860351 14:69658219-69658241 CTGCCCCACCGCCTGCCTGGAGG - Intronic
1119046310 14:71321060-71321082 CTCACTCGCCGCCTCCTCTGCGG - Intronic
1119893077 14:78197615-78197637 CTCCCTTGCTTCCTTCCTGGTGG + Intergenic
1120215780 14:81679552-81679574 CTCCCTCCCCACCTCCCTGCAGG + Intergenic
1120632350 14:86905810-86905832 CTCCCTCCACACCTCCCTGCAGG + Exonic
1121665313 14:95667526-95667548 CTTCCTGCCTGCCTCCCTGGGGG + Intergenic
1122329742 14:100904320-100904342 TTCCTTCGCTTCCTCCCTGGAGG + Intergenic
1122571826 14:102708671-102708693 TTCCCTCCGCGCCTTCCTGGTGG + Intronic
1122793199 14:104193116-104193138 CTCCCACAAGGCCTCCCTGGGGG - Intergenic
1122959666 14:105088558-105088580 CTCCCAGGCAGCCTGCCTGGAGG + Intergenic
1123168520 14:106349219-106349241 CGCCCCCTCCGCCTCCCTGCAGG + Intergenic
1123796935 15:23781819-23781841 CCCCCTCCCCGCCTGCCAGGGGG - Intergenic
1125300926 15:38252756-38252778 CCTCCTCGCCGCATCCCTGAGGG + Exonic
1129253435 15:74320824-74320846 CTCCCTCGCCTGCCCTCTGGTGG + Intronic
1129463475 15:75711455-75711477 CTCCCTTCCCATCTCCCTGGCGG + Intronic
1129721412 15:77879947-77879969 CTCCCTTCCCATCTCCCTGGCGG - Intergenic
1130486785 15:84402579-84402601 CTTCCTCCCAGCCTCCCTGCCGG - Intergenic
1132545460 16:531009-531031 TGCCATCCCCGCCTCCCTGGCGG + Intronic
1132558064 16:581153-581175 GTCTCTCTCCACCTCCCTGGAGG - Intronic
1132919687 16:2380325-2380347 ATCCCTCTCCCACTCCCTGGAGG + Intergenic
1133170096 16:3977525-3977547 CTCCCTCGCCACCGTCGTGGGGG - Exonic
1133258443 16:4533222-4533244 TTCCCTGGCCACCTCCCTGCAGG - Intronic
1134848377 16:17460418-17460440 CTCCCTCCCCGCCTAGCTGGTGG - Intronic
1136775889 16:32871652-32871674 CCCACTCTCAGCCTCCCTGGAGG + Intergenic
1136894727 16:33989860-33989882 CCCACTCTCAGCCTCCCTGGAGG - Intergenic
1136913900 16:34163571-34163593 CTCCCCCACCCTCTCCCTGGCGG - Intergenic
1139402837 16:66696267-66696289 CTCCCTCCCCGCCCCGCTGCGGG - Intronic
1139489548 16:67279156-67279178 CACCCACGCGGCCTTCCTGGCGG + Exonic
1139551452 16:67675295-67675317 CTCCATGGCCGCCTCCTTCGAGG - Exonic
1139960010 16:70712073-70712095 CTCCCCCACCCCCTCCCGGGAGG + Intronic
1140113241 16:72021212-72021234 CCCCCTGGCCGACTACCTGGTGG + Exonic
1140455130 16:75100507-75100529 CTCCCTCATCGCCCCCCAGGAGG - Intronic
1140786933 16:78351437-78351459 CCCCCTCACCCCATCCCTGGGGG - Intronic
1140889335 16:79271833-79271855 CTTCCTCATCACCTCCCTGGTGG - Intergenic
1141694843 16:85614358-85614380 CTCCCGCTCCGCCTCCATGAAGG - Intronic
1142175603 16:88643618-88643640 CTCCCTCCCTCCCTCCCCGGAGG + Intronic
1142291164 16:89194183-89194205 CTCCCCCACCCCCTCCATGGTGG - Intronic
1203078305 16_KI270728v1_random:1133761-1133783 CCCACTCTCAGCCTCCCTGGAGG + Intergenic
1142708546 17:1710789-1710811 TTCCCTCCCCGCGTCCGTGGTGG + Intergenic
1142887506 17:2921887-2921909 CTCCCTCCTCTTCTCCCTGGGGG + Intronic
1144756517 17:17682982-17683004 CTCCCGCGCCGCCTTCCCCGCGG + Intronic
1145264339 17:21372385-21372407 GACCCTGGCCGCCTGCCTGGAGG + Intergenic
1145690269 17:26732052-26732074 AGCCCGCGTCGCCTCCCTGGAGG + Intergenic
1147167705 17:38602204-38602226 CTCCCTCCCTTCCTCCCTCGGGG + Intronic
1147594167 17:41706037-41706059 CTCCCTCACCTCCTACCTGTTGG + Intergenic
1147794828 17:43034825-43034847 CTGCCTCCCCACCTCCCTGGGGG + Intergenic
1147998889 17:44376159-44376181 CTCCTTTCCAGCCTCCCTGGTGG - Exonic
1148432411 17:47652593-47652615 CCCCCTCGCCGCCCCTCTGGTGG + Intronic
1149623650 17:58064548-58064570 CTGCCTCCCTCCCTCCCTGGTGG + Intergenic
1150003560 17:61456297-61456319 GTCCCTCGCCTCCTCCCTTCAGG - Intronic
1151364869 17:73610600-73610622 CTCACTCCCCGCCTCCCTCGTGG - Intronic
1151368969 17:73635492-73635514 TTCCCTGGGCACCTCCCTGGAGG - Intronic
1151969540 17:77450664-77450686 CTTCCTCTCCCCCTCCCTGCAGG - Intronic
1152111451 17:78359641-78359663 CTACCTCGTCACCTCCCTGCCGG + Intronic
1152269487 17:79315738-79315760 CGCCCGTGCCGCCACCCTGGGGG + Intronic
1152379555 17:79935277-79935299 CTCCATCGCCGCCTGCTGGGGGG + Exonic
1153778967 18:8477819-8477841 CTCCCTCACCACCTCCCTACAGG - Intergenic
1154335772 18:13463315-13463337 CTGCCCACCCGCCTCCCTGGAGG + Intronic
1154954784 18:21242790-21242812 CCCCCTCGCCGCCTCCGCCGGGG - Intronic
1156447599 18:37248947-37248969 CTCCCTCCCTCCCTCCCTGCAGG - Intronic
1157834113 18:50883365-50883387 CTCCCTGGCCCCCTACCTGGAGG - Intronic
1160874114 19:1289477-1289499 CTCCCTCTCCTCCTCCCCTGGGG + Intronic
1160960481 19:1718654-1718676 CCCCCTCTCCACCTCCCTGACGG + Intergenic
1161264516 19:3358312-3358334 CACCCTGGCGTCCTCCCTGGGGG + Intergenic
1161430419 19:4229290-4229312 CTCCCCCGCCCCCACCCTCGGGG + Intergenic
1161584662 19:5098747-5098769 CTCCCTCGCCCCCTCCATCATGG + Intronic
1161587422 19:5113213-5113235 CTCCCGCGCCGCCATCCTGGGGG + Intronic
1161791318 19:6361862-6361884 CGCGCTCGCCGCGACCCTGGGGG - Exonic
1162578653 19:11514199-11514221 GTCCCTCGCCGGCTCCCTCGGGG - Exonic
1162934204 19:13973009-13973031 CACCCCCGCCACCTCCCAGGCGG - Exonic
1163145976 19:15379572-15379594 CGCCCTGGCCGCCTCTCCGGAGG + Intronic
1163612263 19:18307774-18307796 CCCCCCCCCCGCATCCCTGGGGG - Intronic
1163612423 19:18308359-18308381 CTCCCTCTCTGTCTCCCTTGGGG + Intronic
1164566169 19:29327514-29327536 TTCCCTCTCCTCCTGCCTGGAGG + Intergenic
1164834882 19:31350200-31350222 CGCGCCCGCCTCCTCCCTGGAGG - Intergenic
1166942036 19:46373164-46373186 GCCCCACGCTGCCTCCCTGGAGG + Intronic
1167072323 19:47228212-47228234 CGCCGTCACCGCCGCCCTGGGGG - Exonic
1167112403 19:47470013-47470035 CTCCCTTGCCGCCCCACTGTGGG - Intronic
1167377675 19:49120247-49120269 CGCCTGCGCCCCCTCCCTGGTGG - Intronic
1167598667 19:50440873-50440895 CTCCTCCACCACCTCCCTGGCGG - Exonic
1167769854 19:51508425-51508447 CTCCCTCTTCTCTTCCCTGGAGG + Intergenic
1168076491 19:53983019-53983041 CTCCCCTGCCCCCTCCCTCGGGG - Exonic
1168544686 19:57240668-57240690 TTCCGTGGCCGCCTCCCTGGCGG + Intronic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
925859291 2:8159543-8159565 CTCCCTCCCAGCCTTGCTGGGGG + Intergenic
925972182 2:9113479-9113501 TTCCCGCCCCGCCTCCCTAGAGG + Intergenic
926185924 2:10690521-10690543 CTGCCTCGCCCCCGCCCGGGAGG - Intergenic
926242571 2:11099914-11099936 CTTCCTCACCACCTGCCTGGCGG + Intergenic
926684631 2:15689558-15689580 CTCCCTCCCAGCCTCGGTGGAGG + Intergenic
926908707 2:17829656-17829678 CTACCTCGCAGCCTTGCTGGAGG - Intergenic
927698493 2:25252651-25252673 CTCCCGAGCCGCCTGCCCGGAGG + Intronic
927708508 2:25311388-25311410 CTCCCTGGGCGGCTCCCTGGAGG + Intronic
928106328 2:28472679-28472701 CTCCCTCCACACCTCCCTGCAGG - Intronic
928615425 2:33033985-33034007 CCCCCTCCCCGGCTCCCTGGGGG + Intronic
930029847 2:47051762-47051784 GTCCATCGCCGCCTCCCGGCTGG + Exonic
930703782 2:54485176-54485198 CTCCCTCTCCGTCTCCCTCTCGG + Intronic
932223551 2:70021073-70021095 CTCCCTCCCCCAGTCCCTGGTGG + Intergenic
932492586 2:72131569-72131591 CTCCCCAGCATCCTCCCTGGTGG - Exonic
933764104 2:85695461-85695483 CTCCTTTCCCTCCTCCCTGGTGG + Intronic
938103940 2:128517074-128517096 CTCCCTCGGTGCCTGCCTGTGGG + Intergenic
941705916 2:168657818-168657840 CTCCCTCCACACCTCCCTGCAGG + Intronic
941820748 2:169841514-169841536 CTCCCTCCACACCTCCCTGCAGG - Intronic
943697277 2:190950098-190950120 CTCCCTCTCCCCCTCCCTTTGGG - Intronic
946751042 2:222896202-222896224 CCCCCCCGCCGCCTCCCTCCCGG + Intronic
947934124 2:233988707-233988729 CTCCCTCACCACCTAGCTGGTGG + Intronic
948483123 2:238262802-238262824 CCGCCTCGCCGCCTCCCTCCTGG - Intronic
948931945 2:241137534-241137556 CTCCCTCCCTCCCTCCCTGCTGG - Intronic
1169193935 20:3673546-3673568 CTCCCTCGCCCCCGCCCGCGGGG + Intronic
1170935446 20:20805439-20805461 TTCCCTAGCTGGCTCCCTGGAGG + Intergenic
1171477034 20:25418850-25418872 ATCCCTCTTCCCCTCCCTGGAGG + Intronic
1171489973 20:25509976-25509998 CTCCCTCACCGCATTTCTGGAGG - Intronic
1172530953 20:35631031-35631053 CTTCCTCACCTCCTCCCAGGTGG - Exonic
1172838240 20:37886654-37886676 ATCCCTCGCCTCCACCCGGGGGG - Intergenic
1173609390 20:44355698-44355720 CGCACTCACCGCCTTCCTGGTGG + Intronic
1174515826 20:51091758-51091780 CTCCCTCCCCACCTACCTGTAGG - Intergenic
1174568053 20:51481154-51481176 CTTCCTCGCCAGGTCCCTGGAGG + Intronic
1175903282 20:62368250-62368272 CCCCCTCGGGGCTTCCCTGGAGG - Intergenic
1176060687 20:63171454-63171476 CTCTCATGCCCCCTCCCTGGAGG + Intergenic
1176087520 20:63304721-63304743 CTCCCTCCCTCCCTCCCTCGAGG + Intronic
1178348307 21:31851068-31851090 CTGCCTGGCTGCCTCCCTGCTGG + Intergenic
1179988238 21:44932721-44932743 CTCCCCAGCGGCCTCCCCGGGGG + Intergenic
1180165207 21:46022216-46022238 CTTCCTCGCGGCCTTTCTGGAGG + Intergenic
1180901751 22:19378014-19378036 CCCCCTCTCGGGCTCCCTGGCGG - Exonic
1180944182 22:19680630-19680652 CGCCCTCTCCCCCTCCCTGCTGG + Intergenic
1181182919 22:21079748-21079770 CTCCCTCGGCACTTTCCTGGAGG + Intergenic
1181833068 22:25578601-25578623 CCAACTCTCCGCCTCCCTGGCGG - Intronic
1182049250 22:27300416-27300438 ACCCCTCGCCCCCTCCCTGAAGG + Intergenic
1184202699 22:42981468-42981490 CCCCCCCGCCGCCTCCCTCCCGG - Intronic
1184728851 22:46362222-46362244 TCCCCTCACCGCCTCCCAGGTGG - Exonic
1203259846 22_KI270733v1_random:167552-167574 CTTCCCCGCCGCCCCCCGGGTGG - Intergenic
949569954 3:5283857-5283879 CTCCCCCCCCGCCTCCCTCCTGG + Intergenic
949883107 3:8676797-8676819 CTCAGTCCCCGCCTCACTGGGGG - Intronic
949883791 3:8679457-8679479 CTCAGTCCCCGCCTCCCGGGGGG - Intronic
949884333 3:8681722-8681744 CTCACTCCCCGCCTCCCAGGGGG - Intronic
950522659 3:13505854-13505876 CTCCCCCGCCCACTTCCTGGAGG - Exonic
950583462 3:13878118-13878140 CTCCCTCCCTCCCTCCCTGCCGG + Intronic
950676194 3:14555798-14555820 CTCCCTCCCCGTCTCTCTCGCGG - Intergenic
953027796 3:39154616-39154638 CTCCCACGAAGGCTCCCTGGAGG - Intergenic
953223665 3:40997784-40997806 CCTCCTCTCTGCCTCCCTGGTGG - Intergenic
958715984 3:97781089-97781111 CACCATAGCCGCCTCCCTAGTGG + Intronic
962270163 3:133971679-133971701 TTCCCTCAGCACCTCCCTGGGGG + Intronic
962277984 3:134030123-134030145 CTCCCTCTCCGCCTCCCGGCAGG - Intronic
962711953 3:138094874-138094896 CTGCCTCTCCGCCTCCCTCTGGG + Exonic
964906784 3:161726833-161726855 CCCCTTCTCCGCCTCCCTGGGGG - Intergenic
966390870 3:179451330-179451352 CGAGCTCGCCGCCTACCTGGAGG + Exonic
966784225 3:183608956-183608978 CCCCCCCGCCGCCTCCCTCCCGG - Intergenic
967904034 3:194486597-194486619 CTCCTCCGCGGCCTCCCTCGCGG + Intronic
968658617 4:1789538-1789560 CTCCCTGCCCACCTCCCTGTCGG + Intergenic
968703764 4:2068967-2068989 CTCGCTCGCCCCCACCCTGGGGG - Exonic
968973577 4:3809699-3809721 CTCCCTCTCCGTCTCCCTCTCGG - Intergenic
969214503 4:5711305-5711327 GTCCCGCGTCGCCGCCCTGGCGG + Exonic
969259158 4:6022728-6022750 CTCCTGCGCCGCCTCCCGGAGGG + Intergenic
969622117 4:8283886-8283908 CTCCAGCACCGCCTCCCTGCTGG + Intronic
969683681 4:8657150-8657172 CTCCCTCACCCCCTCCCAGCTGG - Intergenic
971294500 4:25376977-25376999 CTCCCTCTCCGCGCCCCTCGGGG + Intergenic
974838266 4:67275622-67275644 CTCCCTCCACACCTCCCTGCAGG + Intergenic
978398233 4:108305287-108305309 CTGCCTCCCTGCCTCCCTGAAGG - Intergenic
980570838 4:134617907-134617929 CTCCGTCACAGCCTCCCGGGTGG - Intergenic
981280612 4:142954486-142954508 GGCCTTAGCCGCCTCCCTGGGGG + Intergenic
984206540 4:176793045-176793067 TTCCCTCGCCTCCTCCCCGGCGG + Intergenic
985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG + Exonic
985129644 4:186726716-186726738 CTCCCCCACCGCCTCCAAGGGGG - Intronic
985701644 5:1377073-1377095 CTCCCTGGCTGCCTCCCAGTGGG + Intergenic
985983012 5:3488121-3488143 TCCCCTCTCTGCCTCCCTGGGGG - Intergenic
986236108 5:5912248-5912270 CACACTCCCCTCCTCCCTGGGGG - Intergenic
986313771 5:6572760-6572782 CTTCCTGACCGCCTCCCTGTGGG + Intergenic
988605231 5:32673469-32673491 CTCCCTCCACACCTCCCTGCAGG + Intergenic
988636606 5:32991008-32991030 CTGCGTTGCCTCCTCCCTGGTGG - Intergenic
988796567 5:34657218-34657240 CTCCCGCGACCCCTGCCTGGTGG + Intronic
989374002 5:40740721-40740743 CTCCCTCTCCCCTTCACTGGGGG + Intronic
989587558 5:43087325-43087347 CCCCCCCGCCGCCTCCCTCCCGG + Intronic
991499268 5:67259909-67259931 CTCCATTGCCACCACCCTGGTGG - Intergenic
994742705 5:103641839-103641861 CTTCCTCTCTGCATCCCTGGAGG - Intergenic
996210082 5:120798121-120798143 CTCTCTCCCAGCCACCCTGGTGG - Intergenic
998310434 5:141124047-141124069 CTCTCTCACCGTCTACCTGGTGG + Exonic
998312873 5:141152303-141152325 CTCTCTCACCGTCTACCTGGTGG + Exonic
998313568 5:141158052-141158074 CTCGCTCACCGTCTACCTGGTGG + Intergenic
998315059 5:141174881-141174903 CTCGCTCACCGTCTACCTGGTGG + Exonic
998315637 5:141180089-141180111 CTCTCTCACCGTCTACCTGGTGG + Exonic
998320543 5:141225557-141225579 CTCCCTCACCGTCTACCTGGTGG + Exonic
998321553 5:141236606-141236628 CTCCCTCACCGTCTACCTGGTGG + Intergenic
999251031 5:150182530-150182552 CTACCTCACTGCCTCCCTGATGG + Intronic
1001398477 5:171433115-171433137 CACCCCCGCCACCTCCCTGGGGG + Intronic
1002191389 5:177479586-177479608 CTTCCTTGCCCCTTCCCTGGAGG + Intergenic
1002843691 6:927185-927207 CACCCTGGCCATCTCCCTGGAGG + Intergenic
1003058142 6:2841557-2841579 CTCCCTCCCTCCCTCCCTCGCGG + Intronic
1003175892 6:3751966-3751988 CCCCCGCGCCTCCTCCCTCGCGG + Exonic
1003398523 6:5773130-5773152 CTCCCTCCCCGCCACCCTCTTGG + Intergenic
1003715559 6:8642325-8642347 TTCCCTACCAGCCTCCCTGGGGG - Intergenic
1003717585 6:8665694-8665716 CTCCCTCCACACCTCCCTGCAGG - Intergenic
1003868430 6:10383430-10383452 CTCCCCCGGCGCCTCCCTCGGGG + Intergenic
1005931439 6:30487887-30487909 CTCACTAGCCGCCTCACTAGTGG - Intergenic
1006194229 6:32228174-32228196 CTCCCTCTCTGCCTCCCTGTTGG + Intergenic
1006920844 6:37626171-37626193 CCCCCTCCCCTCCTCCCTGCAGG + Intergenic
1006929560 6:37679598-37679620 CTCCCATGCCGCCTCCCTGGTGG + Intronic
1007327619 6:41073719-41073741 CGCCCCCGCTGTCTCCCTGGTGG + Intronic
1007745972 6:44043105-44043127 CTCCCTTCAGGCCTCCCTGGGGG + Intergenic
1007752231 6:44077387-44077409 CCCCCTGGCAGCCACCCTGGAGG + Intergenic
1007784827 6:44273570-44273592 CTCCCTCCCCACCTCCCTGGGGG + Intronic
1008932462 6:56954904-56954926 CCCACTCGCCGCGTCCCCGGCGG - Intergenic
1009887298 6:69639146-69639168 CCCCCTCGCCATGTCCCTGGAGG + Intergenic
1010816023 6:80359196-80359218 CTCCCTCTCAGCCTCTCCGGAGG + Intergenic
1011416237 6:87122708-87122730 CTCACTCGGCGCCTCCCTCCCGG - Intergenic
1012411437 6:98962519-98962541 CTGCCACTCCGCCTCCCTAGTGG - Intergenic
1015492121 6:133838098-133838120 CTCCCGCGCCTGCTCCCCGGGGG + Intergenic
1015759576 6:136644299-136644321 CTCCCTCCCCACCTACCTGTAGG + Intronic
1017753566 6:157510799-157510821 ATCCCTGGGCGCCTGCCTGGTGG - Intronic
1019177210 6:170166041-170166063 CTCCCTCTCCTCCTGCCTGCTGG - Intergenic
1019305613 7:332998-333020 CTCCAGGGCCGCCTCCCCGGCGG - Intergenic
1019312948 7:371652-371674 CTCACTCTCCTCCTTCCTGGTGG + Intergenic
1019312959 7:371684-371706 CTCACTCTCCTCCTTCCTGGTGG + Intergenic
1019421546 7:953475-953497 TTCCCCCGCTCCCTCCCTGGGGG + Intronic
1019472797 7:1230198-1230220 CGCCCCCGCCCCCTCCCTCGCGG - Intergenic
1019493462 7:1325592-1325614 CTCCCCCATCCCCTCCCTGGGGG - Intergenic
1019495933 7:1340765-1340787 CTCCCGACCCGCCTCCCAGGAGG + Intergenic
1020071213 7:5228170-5228192 CACACTCGCCGCCCTCCTGGGGG - Exonic
1020347654 7:7182770-7182792 CCCCCTCTCCGCCCCCCAGGAGG + Exonic
1021620884 7:22550157-22550179 CTCCCTCCTCGCCCCGCTGGAGG - Intronic
1021731216 7:23597374-23597396 CTTCCGCTCCGCCTCCCTGCCGG - Exonic
1021735802 7:23637783-23637805 CCCCCTCCCCGCCTCCCTCCCGG - Intronic
1023382678 7:39623867-39623889 CACCCCCGCCGCCGCCCGGGTGG - Intronic
1023840997 7:44097354-44097376 CTCCTCCCCCGCTTCCCTGGTGG - Intergenic
1024934363 7:54698023-54698045 CTCCCTCCCCATCTCCCAGGAGG - Intergenic
1028417583 7:90596366-90596388 CGCGCTCGCCGCCGCCGTGGTGG - Intronic
1029158878 7:98537077-98537099 CTCCCTTTCCCCCTCCCTGCAGG - Intergenic
1029545650 7:101209082-101209104 CTCCCTCAGCCCCTACCTGGCGG - Intronic
1032120373 7:129150805-129150827 CTCTCTTTCCTCCTCCCTGGAGG - Intronic
1032196607 7:129792919-129792941 CCCCCTCTCCTCCTCCCCGGCGG - Intergenic
1034266209 7:149782250-149782272 CGCCATCTCCGTCTCCCTGGAGG + Intergenic
1034306378 7:150048054-150048076 CTCCTCCGCCCCCTCCCCGGCGG + Intergenic
1034638769 7:152586247-152586269 CCCCCCCGCCGCCTCCCTCCCGG + Intergenic
1034800468 7:154052588-154052610 CTCCTCCGCCCCCTCCCCGGCGG - Intronic
1034971107 7:155419763-155419785 CTGGCTCATCGCCTCCCTGGTGG - Intergenic
1035169273 7:157008963-157008985 CTCCCTCGGCCCCACCTTGGAGG + Intronic
1035243964 7:157550484-157550506 CTCGCGCCCGGCCTCCCTGGTGG - Intronic
1035421980 7:158737328-158737350 CTCCCCCGACGGCTGCCTGGTGG + Intronic
1035698614 8:1620969-1620991 CTCACTCCCCGCCTCCCAGCTGG + Intronic
1036135022 8:6152689-6152711 CTCCCTCCACACCTCCCTGCAGG - Intergenic
1036560673 8:9898465-9898487 CTCCCTGGCCGGGTCACTGGGGG + Intergenic
1036571149 8:9980598-9980620 CTCCCTCTCTGCCTCCCTCCTGG + Intergenic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1039061263 8:33573885-33573907 CTCCCTCCACACCTCCCTGCAGG - Intergenic
1040530870 8:48265453-48265475 CTCCCTCCCAGCCTGTCTGGGGG - Intergenic
1040622280 8:49103397-49103419 CTCCCTCCACACCTCCCTGCAGG + Intergenic
1041350810 8:56946322-56946344 CCCCCTCTCACCCTCCCTGGTGG - Intergenic
1044542251 8:93420998-93421020 CTCCCTCTCTCCCTCCCTGCTGG - Intergenic
1046849012 8:118952076-118952098 CTCACGCCCCACCTCCCTGGGGG - Exonic
1048981307 8:139704366-139704388 CGCCCCCGCCCCCTCCCTGGCGG - Intergenic
1049576217 8:143391151-143391173 CTCCCCCCCCGCCCACCTGGAGG + Intergenic
1049692104 8:143965986-143966008 CTCCCTCCCTGCCACCCTGCTGG + Intronic
1051666358 9:19470277-19470299 CACCCTGGCCACATCCCTGGAGG + Intergenic
1052739456 9:32379544-32379566 CTCCCTTGCCCCATCCTTGGTGG - Intergenic
1052858717 9:33423608-33423630 CCCCCCCGCCGCCTCCCTCCCGG - Intergenic
1053129620 9:35607575-35607597 CTTCCTTGCCCCCTCCCTGCAGG - Exonic
1053393360 9:37751859-37751881 CTCCCTCCCCACCTCCCGGCAGG - Intronic
1055539368 9:77286320-77286342 CTTCCTGTCAGCCTCCCTGGTGG - Intronic
1057227003 9:93297765-93297787 CTCCCACGCCACCTCCCTCCTGG + Intronic
1058058696 9:100473779-100473801 CTCCGTTGCCGCCTCCCTCGTGG + Intronic
1059414665 9:114155551-114155573 CTGCCTCCCCGCCGGCCTGGGGG - Exonic
1059447347 9:114346710-114346732 CTGGCTCGCTGCCTTCCTGGAGG + Exonic
1061151642 9:128831922-128831944 CTCCATCTCTGCCTCCATGGAGG - Intergenic
1062250769 9:135592512-135592534 CTCACTCACCCCCACCCTGGAGG - Intergenic
1062389254 9:136327540-136327562 CTTCCTCGGCGCCTCCCCGGGGG + Exonic
1062407816 9:136405363-136405385 CTCCCTGCACGCCTGCCTGGTGG - Intronic
1062577416 9:137215181-137215203 CTCCATCGCCTCCTCGCTGCTGG + Exonic
1062584839 9:137244566-137244588 CTGCCTGGCAGCTTCCCTGGAGG - Intronic
1188180663 X:27051133-27051155 CTCACACGCTGCCTCCCAGGAGG + Intergenic
1190597571 X:52063637-52063659 CACCCTCTCCCCGTCCCTGGAGG - Intronic
1190611253 X:52190436-52190458 CACCCTCTCCCCGTCCCTGGAGG + Intronic
1192033798 X:67543673-67543695 CTCCCTCGCCTCCACCCTGTTGG + Intergenic
1192169530 X:68845759-68845781 GTCCCTCCCAGCCTCCCTAGTGG + Intergenic
1192234538 X:69287308-69287330 CTCCCTCCCCTCCTCTCTGGGGG - Intergenic
1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG + Exonic
1195214374 X:102683885-102683907 CTCACTCACCCCCTCCCTGAGGG + Intergenic
1195716872 X:107826441-107826463 CCCCCTCGCCGCGGCCCTGGAGG + Intronic
1200069674 X:153521939-153521961 CTCCCACACCCACTCCCTGGTGG + Intronic
1200103997 X:153702386-153702408 CCCACTCTCAGCCTCCCTGGAGG - Intronic
1202369313 Y:24186439-24186461 CTTCCTCCCAGCCTCCCTGCCGG - Intergenic
1202501472 Y:25483678-25483700 CTTCCTCCCAGCCTCCCTGCCGG + Intergenic