ID: 1037889701

View in Genome Browser
Species Human (GRCh38)
Location 8:22617408-22617430
Sequence CTGCCTCTGTAGAAGGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 756
Summary {0: 1, 1: 0, 2: 5, 3: 77, 4: 673}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037889695_1037889701 2 Left 1037889695 8:22617383-22617405 CCTGCCTTTTCCTTATAACCTTT 0: 1
1: 0
2: 3
3: 32
4: 477
Right 1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG 0: 1
1: 0
2: 5
3: 77
4: 673
1037889697_1037889701 -8 Left 1037889697 8:22617393-22617415 CCTTATAACCTTTGTCTGCCTCT 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG 0: 1
1: 0
2: 5
3: 77
4: 673
1037889696_1037889701 -2 Left 1037889696 8:22617387-22617409 CCTTTTCCTTATAACCTTTGTCT 0: 1
1: 0
2: 1
3: 42
4: 431
Right 1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG 0: 1
1: 0
2: 5
3: 77
4: 673

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037889701 Original CRISPR CTGCCTCTGTAGAAGGAGGA TGG Exonic
900381733 1:2387530-2387552 CTGCATGTGGACAAGGAGGAGGG + Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
900475414 1:2874132-2874154 CTGCCTCTGTCGCATGAGGAAGG - Intergenic
900510546 1:3058142-3058164 CTGGCTCTGAAGACAGAGGAAGG - Intergenic
900595865 1:3479892-3479914 CTGGTTCTGCAGCAGGAGGATGG + Exonic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900783354 1:4632056-4632078 CTGGCTTTGAAGACGGAGGAGGG - Intergenic
900893177 1:5464408-5464430 CAGCCTCTGTAGAAAATGGATGG - Intergenic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
900961234 1:5922133-5922155 CTGCCTTTGAAGATGGAAGAAGG + Intronic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
901654241 1:10760230-10760252 CAGCCTCTGGAGATGGAGAAAGG + Intronic
901714012 1:11138653-11138675 CTTCCTTTTAAGAAGGAGGAAGG + Intronic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
902293596 1:15451105-15451127 CTGGCTCTGAAGATAGAGGAAGG + Intergenic
902725127 1:18330485-18330507 ATGCCACTGTAGCTGGAGGAAGG + Intronic
902744352 1:18463523-18463545 CTGGCTCTGAAGACAGAGGATGG - Intergenic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
905019784 1:34801071-34801093 AAGGCTCTGAAGAAGGAGGAAGG + Intronic
905108668 1:35578660-35578682 TTGGCCCTGGAGAAGGAGGAGGG + Intronic
906039975 1:42781236-42781258 CAGCCTCTGTGGAAGCAGGGAGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906837218 1:49096907-49096929 CTGGCTCTGAAGATGAAGGAAGG + Intronic
907330064 1:53664933-53664955 AGGCCTCTGTGGCAGGAGGAGGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907564649 1:55423657-55423679 CTGCCTCTTGAGAAGAAGTAAGG - Intergenic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908602749 1:65758773-65758795 CTGACACTGTGGAAGGAAGATGG + Intergenic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913989007 1:143592376-143592398 CTGCATTTGAAGTAGGAGGATGG + Intergenic
914873489 1:151494807-151494829 CTGCCTATATGGAAGCAGGAGGG - Intergenic
914998646 1:152566501-152566523 CTGCCTGAGTAGAAAGAGGATGG + Intronic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916220600 1:162440954-162440976 CCGACTCTGTAGCAGCAGGAGGG - Intergenic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
917608723 1:176664368-176664390 CAGGCTTTGAAGAAGGAGGAAGG - Intronic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918124463 1:181570669-181570691 CTGACTCTGAAGATAGAGGAAGG - Intronic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
918978316 1:191520690-191520712 CTTTCTCTCTAGAAGGAAGAAGG - Intergenic
920203831 1:204277195-204277217 CTGGCTCTGGAGAACCAGGAGGG + Intronic
921218407 1:212955918-212955940 CTGCCTCTGTTGCAGGAGCCTGG + Intronic
921412446 1:214850232-214850254 CTGCCTTTGAAGATAGAGGATGG + Intergenic
921686544 1:218095449-218095471 CAACCTCTGTGGAAGGAAGAGGG + Intergenic
921951007 1:220929945-220929967 CTACCTCTGTAAAAGAAGAAAGG - Intergenic
922226848 1:223652871-223652893 CTGCCAATGGAGAAGGAGGCTGG - Intronic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
923098718 1:230795505-230795527 GTGCCTCTGTGGGAGGATGATGG + Intronic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923639553 1:235740425-235740447 TTGTCTCTGTGGAAGGGGGACGG - Intronic
924581715 1:245329564-245329586 CAGCCACTGCAGAAGCAGGACGG - Intronic
1063163458 10:3438249-3438271 CTGGCACTGAAGAAGTAGGAAGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1065478833 10:26171713-26171735 CTGCCTCAGGAGCAGGAGGCTGG + Intronic
1065927737 10:30450643-30450665 ATGTCTCTGGAGAAGGAAGACGG - Intronic
1066615641 10:37290973-37290995 CTGCCAATGGAGATGGAGGAAGG + Intronic
1067185708 10:44025344-44025366 GCCCCTCTGTAGAATGAGGATGG + Intergenic
1067454250 10:46404938-46404960 CTGCCTTTGAGGATGGAGGAAGG - Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067632953 10:47979694-47979716 CTGCCTTTGAGGATGGAGGAAGG + Intergenic
1067741877 10:48901734-48901756 ATGCCTCTGCAGCAGGAGAAAGG + Intronic
1068119888 10:52774636-52774658 CTGCCACTGGAGCAGGAGCAGGG - Intergenic
1069086573 10:64146843-64146865 CTGACTTTGCAGATGGAGGAAGG + Intergenic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1069775433 10:70924468-70924490 CTGCCTGGGTTGAAGGTGGATGG - Intergenic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070448916 10:76537572-76537594 CTGGCTCTGAAAATGGAGGAAGG - Intronic
1070794024 10:79206621-79206643 CTGCCTTTGCAGAAGGAGCCAGG + Intronic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072056466 10:91762496-91762518 CTGGCTTTGTAGAATGAGTAAGG - Intergenic
1072706739 10:97686652-97686674 CTGCTTCTGTAGATTGTGGAAGG + Intronic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074944892 10:118271761-118271783 CTGCCTCAGCAGAAGCAGCAGGG - Intergenic
1075047355 10:119156598-119156620 GTGCCTCTGGAGATGAAGGAAGG + Intronic
1075254946 10:120918324-120918346 CTGCCACTTTAAAAGAAGGAAGG + Intergenic
1075264362 10:120988202-120988224 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1075446280 10:122515724-122515746 ATGCCTCTGTGGATGGAGGAAGG - Intergenic
1075574763 10:123570403-123570425 CAGGCTCTGGGGAAGGAGGAAGG - Intergenic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076167123 10:128291821-128291843 AAGCCACTGAAGAAGGAGGACGG - Intergenic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1076520167 10:131076343-131076365 CTGGCTCTGTAGAAGCAGTCCGG - Intergenic
1076585759 10:131546434-131546456 GTGCCTGTGGAGAAGGTGGAGGG - Intergenic
1077253566 11:1571277-1571299 CTGCCTCTGCAGCAGGCGGAAGG + Intronic
1077482434 11:2822101-2822123 CTGGCTTTGAAGACGGAGGAGGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079059593 11:17236583-17236605 CTGACTCTCTTGGAGGAGGAGGG - Intronic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079934034 11:26596283-26596305 CTGCCTCTGTAGAAGGATTTTGG + Intronic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1082720652 11:56671451-56671473 CTGCCTCCGATGAAGTAGGACGG - Intergenic
1082980305 11:59114766-59114788 CTGACACTGTAGAGGGAGAAAGG + Intronic
1083106361 11:60361908-60361930 CTACCTCTGGGGAAGGAGGGAGG + Intronic
1083178988 11:60972258-60972280 CTGCCTCTCTGGAAGGTGAACGG - Intronic
1083970665 11:66072001-66072023 TTACCTTTGTAGAAGGAAGAGGG - Intronic
1084563486 11:69916999-69917021 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1084702369 11:70795796-70795818 CTGGCTTTGGAGACGGAGGAAGG + Intronic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1085044748 11:73346389-73346411 CTTCCTCTGTAGCAGGGTGATGG + Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085342310 11:75740980-75741002 CTACCTGTGGAGATGGAGGAAGG - Intergenic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1087332930 11:96805619-96805641 CTGGCTTTGAAGACGGAGGATGG - Intergenic
1087561807 11:99799751-99799773 CTGCCTTTGTAGAATGAGTTAGG + Intronic
1088363280 11:109013262-109013284 GTGACCCTGTGGAAGGAGGATGG - Intergenic
1088754580 11:112875341-112875363 TAGCCTCTGTTTAAGGAGGAAGG + Intergenic
1089147959 11:116344131-116344153 CTTACTCTGAAGATGGAGGAAGG - Intergenic
1089333610 11:117707403-117707425 CAGCCCCTGTGGGAGGAGGATGG - Intronic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089674261 11:120079534-120079556 CTCCCTCTCTAGGAGGAGGAAGG - Intergenic
1089820357 11:121220234-121220256 CTGACTTTGAAGATGGAGGAAGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1090231446 11:125109368-125109390 TTGCCTCTGCAGAGGGAGGAAGG + Intronic
1090334193 11:125951768-125951790 ATGGCCCTGTGGAAGGAGGAAGG - Intergenic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1091223088 11:133942155-133942177 TTTCCTCTCGAGAAGGAGGATGG + Intronic
1091800911 12:3323988-3324010 CTTCCTCTGTAGAACAGGGAGGG - Intergenic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1092805965 12:12222739-12222761 CTGATTCTGTAGATGTAGGATGG - Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1093372894 12:18386064-18386086 TTGGTTCTGTGGAAGGAGGAGGG - Intronic
1093823640 12:23653685-23653707 CTCACACTGTAGAAGGAGCAAGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096370803 12:51067519-51067541 CTTACTCTGTTGACGGAGGAGGG + Intronic
1096418082 12:51431114-51431136 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1099825539 12:87772587-87772609 CTGCCCCTGTTGAATGAGCAGGG + Intergenic
1100214643 12:92434959-92434981 CTGTCTCTAAAGAAAGAGGAAGG - Intergenic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1101136341 12:101747654-101747676 CTTCATCTGTAGGAGGAGGCAGG + Intronic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1102185821 12:110947868-110947890 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1102778928 12:115546709-115546731 GTGCCTCTGTTTGAGGAGGAGGG + Intergenic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1103936494 12:124480208-124480230 CTCCCGCTGCAGGAGGAGGATGG + Intronic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104695178 12:130858055-130858077 CTGGCACTGAAGATGGAGGATGG - Intergenic
1105009056 12:132742957-132742979 ATGCATCTGTAGAACCAGGAGGG - Intronic
1105705737 13:22966467-22966489 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1105818114 13:24055415-24055437 CTGCCTAGGGAGATGGAGGATGG + Intronic
1105858640 13:24391452-24391474 CAGCATCTGGAGAAGGCGGAGGG + Intergenic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106750200 13:32756349-32756371 CTTCCTCTGTAGAAGGAGAATGG + Intronic
1107269482 13:38598404-38598426 CGACGTCTGTGGAAGGAGGAAGG + Intergenic
1107323621 13:39216008-39216030 CTGGCTTTGAAGAATGAGGAAGG - Intergenic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1107999239 13:45891185-45891207 CTGACTCTGTTGATGGAGGGAGG - Intergenic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1109393786 13:61726740-61726762 CTCCATGTGTCGAAGGAGGAAGG - Intergenic
1109491373 13:63104865-63104887 CTGGCTCTGAAGATGGTGGAAGG - Intergenic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110600605 13:77368218-77368240 CTGGCTTTGTAGAAGGAGTTAGG - Intergenic
1111650906 13:91089607-91089629 CTCCCTTTCTAGAAGTAGGATGG - Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112326361 13:98444945-98444967 CTGCCACTGGGGGAGGAGGATGG + Intronic
1112669609 13:101619424-101619446 CTGCCTTTGAAGATGGAGAAAGG + Intronic
1113043436 13:106128526-106128548 CTGGCTTTGGAGATGGAGGAAGG - Intergenic
1113201573 13:107872081-107872103 CTGCCTCAGTAGAACTAGGCTGG + Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1113869199 13:113547662-113547684 CTGCATCTGTCAGAGGAGGACGG - Intronic
1113883882 13:113647237-113647259 CTGCCTCTGAAGAAAGAGTGGGG + Intergenic
1113920197 13:113903479-113903501 CTGCCTCTCTGGCAGGAGGACGG + Intergenic
1113936158 13:113996203-113996225 CTGCTTCTCTAGGAGGAGGCTGG - Intronic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1113987034 13:114325456-114325478 GTGCTTCTGGAGAAGCAGGAGGG - Exonic
1115430315 14:33309898-33309920 CTGGCCCTGCAGAGGGAGGAGGG + Intronic
1117129806 14:52674709-52674731 TTGCCTCTGAAGAAGGAGTGTGG + Intronic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1118360962 14:65055994-65056016 TTACCTCTGGAGAAGGAGGGAGG - Intronic
1118708867 14:68503421-68503443 CAGCCTCTGGAGGAGGGGGAAGG - Intronic
1119076477 14:71645117-71645139 CTGGCTTTGGAGATGGAGGAAGG - Intronic
1119723792 14:76909504-76909526 ATGCCTCTGCAGAAGAAAGAAGG + Intergenic
1119834570 14:77736778-77736800 TTGCCTCTGGGGAAGGAGGTAGG - Intronic
1119926332 14:78497831-78497853 CTTCCTCTGTAGGATGAGAATGG + Intronic
1120639085 14:86987971-86987993 TTGCCTCTGTAAATGGAGAAAGG - Intergenic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1121047834 14:90800880-90800902 CTGGCTTTAAAGAAGGAGGAAGG + Intronic
1121510775 14:94511684-94511706 CTGCCTCTTTGGAAGGAAGCAGG - Intronic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1122112634 14:99513021-99513043 CTGCCTCCGTAACAGCAGGAGGG + Exonic
1122352425 14:101103788-101103810 CTGCCTCTGGGGGAGGCGGAGGG - Intergenic
1122373183 14:101240630-101240652 CTGGCTTTGAAGACGGAGGATGG + Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1202908805 14_GL000194v1_random:97951-97973 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1123440845 15:20290020-20290042 ATGCCTCTGTGGAAAGAGGGAGG - Intergenic
1124244368 15:28056978-28057000 CTGCCTCTGCTGAACTAGGAGGG - Intronic
1124375889 15:29128391-29128413 CTCCCTCTGAAGAAGGTGGCTGG - Intronic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1126318113 15:47392496-47392518 CTGGCTTTGAAGACGGAGGAAGG + Intronic
1126466985 15:48969785-48969807 CTGCCTTTGGAGATGGAGGAAGG + Intergenic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1127299291 15:57637021-57637043 CTGCCTCTGAAGCTGCAGGAGGG - Intronic
1127524336 15:59777297-59777319 CTGCCTAAGTGGAAGGAGAATGG - Intergenic
1128215464 15:65931252-65931274 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128317148 15:66668139-66668161 CTGACTTTGAAGATGGAGGAAGG + Intronic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1128895997 15:71374603-71374625 CAGCCTCTGAAGAAGCTGGAGGG - Intronic
1129869573 15:78931920-78931942 CTGCCTCTGTGGAGAAAGGAGGG - Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1130849112 15:87776671-87776693 CTGCTTCTGTAGACCCAGGAGGG - Intergenic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1132009018 15:98257919-98257941 CTGCCTCTGCTCAAGGAGGCTGG - Intergenic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1132355423 15:101168039-101168061 CTTCCTCTTCAGGAGGAGGAGGG + Intergenic
1132414014 15:101607820-101607842 CTGCCTTTGAAGGCGGAGGAAGG + Intergenic
1132415161 15:101614189-101614211 CTGCTCCTGGGGAAGGAGGAAGG - Intergenic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1133815411 16:9193798-9193820 CTGGCTTTGGAGAGGGAGGAAGG - Intergenic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134742229 16:16558121-16558143 CTGCCCTTGAAGATGGAGGAAGG + Intergenic
1134925335 16:18154335-18154357 CTGCCCTTGAAGATGGAGGAAGG - Intergenic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1136530835 16:30867887-30867909 CTGACTCTGAAGATGGAGGGAGG + Intronic
1137563354 16:49517016-49517038 GCTCCTCTGTACAAGGAGGAAGG - Intronic
1137622771 16:49887155-49887177 CTGACTCTGAACATGGAGGAGGG - Intergenic
1137737403 16:50735199-50735221 CTGGCTCTGAAGGTGGAGGAAGG + Intergenic
1138234499 16:55370558-55370580 CAGCCGCTGGAGAAGGAGGAAGG - Intergenic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140247382 16:73263648-73263670 CTGCTGCTGCAGAAGGACGATGG - Intergenic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1141079012 16:81034760-81034782 CTGATTCTGGAGATGGAGGAAGG + Intergenic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141304366 16:82847427-82847449 CTGACTTTGAAGATGGAGGAAGG - Intronic
1141406037 16:83794013-83794035 CTGCCTCTGAAGATGAAGGAAGG + Intronic
1141742579 16:85903823-85903845 GTGCCTCTATAGAATGAGGGTGG - Intronic
1142000410 16:87661153-87661175 CTGGCTCTGAAGGTGGAGGAGGG - Intronic
1142152003 16:88516789-88516811 CTCTCTTTGTAGAAGGAGAAGGG + Intronic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142867523 17:2799765-2799787 CTGCCTCTGGAGAGGGAGGAGGG + Intronic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1143348193 17:6265908-6265930 CTGCCTTTGAAGATGGAGGAAGG - Intergenic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144338659 17:14295684-14295706 CTGCACCTGTAGAAGGAAGGAGG + Intergenic
1144398242 17:14867102-14867124 CTGTATCTGTAGCAGGAAGAGGG + Intergenic
1144506548 17:15836248-15836270 CTGCCTCTGTTAAAAGAGGTGGG + Intergenic
1144769357 17:17750985-17751007 CCTCCTCTGTGGAAGGCGGAAGG - Intronic
1145170722 17:20654180-20654202 CTGCCTCTGTTAAAAGAGGTGGG + Intergenic
1146537831 17:33668439-33668461 CTGACTTTGAAGATGGAGGAAGG - Intronic
1146581326 17:34040533-34040555 CTGCCTCTGTAATAGGTAGATGG - Intronic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1146957117 17:36942347-36942369 CCACCTCCGTAGAAGGAGAAGGG - Exonic
1147145668 17:38483067-38483089 CTTTCTCTGTAGAAGGCAGAGGG + Intronic
1147646612 17:42038123-42038145 CTGCCTCAGTAGGGGCAGGAGGG - Intronic
1147778247 17:42919480-42919502 TTGCCTCTGGAGAGAGAGGAAGG - Intergenic
1148444799 17:47731047-47731069 ATGCCTCTGGAGGAAGAGGAAGG - Intergenic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149173950 17:53846771-53846793 CTGGCTTTGAAGAAAGAGGAAGG - Intergenic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1151699376 17:75734837-75734859 GTGCCTCTGGGGAAGGAGGCAGG + Intronic
1152177662 17:78798395-78798417 GTGCCCCTGTGGAAGGAGGTCGG - Exonic
1152307170 17:79527925-79527947 CTGACTCGGCAGAAAGAGGAAGG - Intergenic
1152797556 17:82315620-82315642 GTGCCTCTGAAGAAGGAGAGTGG + Intronic
1152848853 17:82619452-82619474 CTCCCTGTGTAGCAGGAGCAGGG - Intronic
1152988019 18:337169-337191 CTGCTTCTGTAGAAAAAGTAAGG - Intronic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153811152 18:8752989-8753011 CTGCTCCTGTATAAAGAGGATGG + Intronic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1154151668 18:11910945-11910967 CTGACTCCGGAGATGGAGGAAGG + Intergenic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1157179817 18:45487227-45487249 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1157306984 18:46524736-46524758 CTCTCCCTGAAGAAGGAGGATGG - Exonic
1158190077 18:54817714-54817736 CTGACTGTGTAGAAGGTGGATGG - Intronic
1158219320 18:55133893-55133915 CTGCCCTTGAAGATGGAGGAAGG + Intergenic
1158318415 18:56237379-56237401 CTGGGTTTGAAGAAGGAGGAAGG + Intergenic
1158452590 18:57580530-57580552 CTGCTCCTGTGGAAGGAGAAGGG + Intronic
1158683778 18:59594221-59594243 ATTCATTTGTAGAAGGAGGACGG - Intronic
1159006880 18:63021148-63021170 CTGCCTCTTGAGCAAGAGGAAGG - Intergenic
1159828515 18:73244232-73244254 CTGTCTCTGTTGCAGGGGGAAGG - Intronic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160408360 18:78658669-78658691 GTGCCCCTGCAGCAGGAGGAAGG + Intergenic
1160510027 18:79448247-79448269 CTGCCTCTGCAGGAGGAGAGGGG + Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1161998094 19:7726794-7726816 CTGCCTTTGAAGATGGAAGAAGG + Intergenic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1163133091 19:15288747-15288769 CTGCCCCTGCAGATGGAGGAGGG + Intronic
1163162799 19:15475632-15475654 CAGCCTCTGTAGAAGGACAAGGG + Exonic
1165161107 19:33816946-33816968 CTGTCTCTGGAGAATCAGGAGGG - Intergenic
1165372231 19:35416036-35416058 CTGCCTCTGATGAAGAAGGTAGG - Intergenic
1165412452 19:35670420-35670442 CTGCCTGTGTAGAAAAACGAAGG - Intronic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166593986 19:44028104-44028126 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166599654 19:44082721-44082743 CTGCTTTTGAAGATGGAGGAAGG - Intronic
1166601753 19:44101859-44101881 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1166603571 19:44119498-44119520 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1167737872 19:51308104-51308126 CAGCCTCTGTGGAAGGGAGAGGG - Intergenic
1168148155 19:54430796-54430818 CAGCCTCTGCAGAAAGAGAAAGG - Exonic
1168222987 19:54974483-54974505 CTGCTTCTGAAAAAGGAGAAGGG - Exonic
1168250602 19:55139511-55139533 CTGCCTCTGAAGATGAAAGAAGG - Intronic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
925036697 2:692558-692580 CTGTCTCTATAGGAGGAAGAGGG + Intergenic
925286506 2:2719557-2719579 CTCCCACTGTGGAAGGAGGTAGG + Intergenic
925399732 2:3563705-3563727 TTGCCTCTAGTGAAGGAGGAGGG + Intergenic
925435408 2:3833086-3833108 CTGCCTTTGAAGACAGAGGAAGG - Intronic
926490070 2:13514480-13514502 CTGACTCTGTAAAAGCAGAACGG - Intergenic
926889151 2:17624622-17624644 CTGCTTTTGAAGAAGGAGGAAGG + Intronic
926988966 2:18656210-18656232 CTGGCTCTGTCTGAGGAGGATGG + Intergenic
927138531 2:20114448-20114470 CCGCCTCTGGAGAAGGATGATGG - Intergenic
927149177 2:20186002-20186024 CTGCCTCTGTGGGAGAAGGGAGG - Intergenic
927203062 2:20590421-20590443 CCTTCTCTGTAGAAGGATGATGG + Intronic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
929023571 2:37577575-37577597 CTATCTCTCTAGAAGGAGGAAGG + Intergenic
929037762 2:37711191-37711213 GTGACTCTGAAGATGGAGGAGGG + Intronic
930267650 2:49218618-49218640 CTGCCTCTGTAGATGTAGTTTGG - Intergenic
930590912 2:53324737-53324759 CTGCCTTTGAAAATGGAGGAAGG + Intergenic
931052922 2:58434205-58434227 CTGACTTTGAAGATGGAGGAAGG - Intergenic
931500038 2:62855451-62855473 GTTCCTGGGTAGAAGGAGGAAGG + Intronic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
931528221 2:63182647-63182669 CTGGCTCTGTAGAATGAGTCAGG + Intronic
931709164 2:64972949-64972971 CTGCATCTCAAGCAGGAGGAAGG - Intergenic
932284471 2:70520678-70520700 CTGCCTTTGTTGAAGTAGGGAGG - Intronic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
933708163 2:85306602-85306624 CAGCCTCTGCAAGAGGAGGAAGG + Intronic
934158008 2:89221240-89221262 GTGACTCTGAGGAAGGAGGAAGG + Intergenic
934209257 2:89961184-89961206 GTGACTCTGAGGAAGGAGGAAGG - Intergenic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
935605297 2:104966486-104966508 GTGTCTCTGTAGAGGAAGGAGGG + Intergenic
935725867 2:106023598-106023620 CTGGCTCTGAAGGTGGAGGAAGG - Intergenic
937927613 2:127179228-127179250 CAGACTCTGGAGATGGAGGAAGG - Intergenic
937952981 2:127402436-127402458 CTGCCACTGTTGGAGAAGGAAGG - Intergenic
938906834 2:135845088-135845110 TTTCCTCTGTAGAAAGGGGAAGG + Intronic
938998474 2:136705950-136705972 CTGACTTTGAAGATGGAGGAAGG + Intergenic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
939073293 2:137569124-137569146 CTGCCTCCGGAGATGGAGAAAGG + Intronic
939350905 2:141036539-141036561 CTGCCTCTAGAAAAGGAGCAGGG + Intronic
939462432 2:142514104-142514126 CTGCCTTTGAAGATGAAGGAAGG - Intergenic
940005462 2:149006068-149006090 CTGCTGCTGTAGCACGAGGATGG - Intronic
940214228 2:151288380-151288402 CTGGCCCTGAAGATGGAGGAAGG + Intronic
940359591 2:152782987-152783009 CTACTTCTGGATAAGGAGGAAGG - Intergenic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
941576904 2:167244091-167244113 CTGCCTCTGAAGAAGAAAAAGGG + Exonic
942420591 2:175803088-175803110 CAACCTCTGTTGAAGAAGGAAGG + Intergenic
942575904 2:177363322-177363344 CTGCCTCTGTGATAGGTGGAAGG - Intronic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943070433 2:183134991-183135013 CTGACTGTGAAGATGGAGGAAGG - Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
943976529 2:194485479-194485501 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
945157640 2:206856322-206856344 CTGACTCTGTTGGAGCAGGATGG + Intergenic
945562850 2:211359704-211359726 CAGCCTCTGATGAAGCAGGAGGG + Intergenic
946290597 2:218741660-218741682 CTGCTTTTCTGGAAGGAGGATGG - Intronic
946661007 2:221999409-221999431 CTGCCTCTGCAGATGGAATATGG + Intergenic
947406304 2:229781103-229781125 GAGCCTCTGCAGAAGGTGGAAGG + Intronic
947531955 2:230914938-230914960 CTGACTCTGTGGAAGGAGAGAGG + Intronic
948036944 2:234865389-234865411 CTGGCTCTGACGATGGAGGAAGG - Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948345799 2:237297093-237297115 CTGGCTCTGAAGGTGGAGGAAGG - Intergenic
948442589 2:238004885-238004907 CTCCCTCTGGAGATGGAGGAAGG + Intronic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
1169609503 20:7363151-7363173 TTGCTTCTGAAGAAGGAGAAAGG + Intergenic
1169713511 20:8590671-8590693 CTGCCTTTGAAGTTGGAGGAAGG - Intronic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1170436216 20:16332253-16332275 CTGTCTCTGTAAAACAAGGAGGG + Intronic
1170635605 20:18101528-18101550 GGGCCTTTGGAGAAGGAGGATGG + Intergenic
1170661677 20:18347480-18347502 TTTCCTCTGGAGAAGGAGGTAGG - Intergenic
1170693595 20:18637278-18637300 CTGCCTGTGTGGCAGGGGGAAGG - Intronic
1171207324 20:23291073-23291095 CTGCCTCTGTGGAGGCAGGGAGG - Intergenic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1172322184 20:34004162-34004184 CTTCCTTTGTACATGGAGGAGGG + Intronic
1172654795 20:36530076-36530098 CTGCCACAGCAGAAGCAGGAAGG - Intergenic
1172840384 20:37899512-37899534 CTCCATCTGTAAAAGAAGGAAGG + Intergenic
1172901338 20:38337028-38337050 CTGCCTCTTAGGAAGGAGAAAGG - Intronic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173190743 20:40873855-40873877 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1173570326 20:44071641-44071663 CTGCCTCCCAAGAAGGAGGAAGG - Intergenic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1174550967 20:51361257-51361279 CTGGCTTGGTAGATGGAGGAAGG - Intergenic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175428529 20:58887249-58887271 TTGCCACAGTAGAAGCAGGAAGG + Intronic
1175494502 20:59404287-59404309 CTGCCTCTGGTGAACGAGGCGGG - Intergenic
1175641748 20:60636015-60636037 CTACCTGTGAAGATGGAGGAAGG - Intergenic
1176046467 20:63095362-63095384 CTGGCTCTGAAGACGGAGGATGG + Intergenic
1176152001 20:63596191-63596213 CTGTGCCTTTAGAAGGAGGAAGG - Intronic
1176427398 21:6557261-6557283 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176628166 21:9112614-9112636 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1178757702 21:35368239-35368261 CTGCCTTTGTTAAAGGAGAATGG - Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179182490 21:39057629-39057651 CTGGCTTTGAAGGAGGAGGAAGG - Intergenic
1179402832 21:41099966-41099988 CTGCCTTTGAAAATGGAGGAAGG - Intergenic
1179553460 21:42157813-42157835 CTGCCTTTGAAGAGGGAGGAGGG - Intergenic
1179702889 21:43165578-43165600 CTGCCTTTGAAGGTGGAGGAGGG + Intergenic
1179990336 21:44944991-44945013 CTGCATCTGTTGAACGAGGCTGG + Intronic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1180378983 22:12120793-12120815 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1181901923 22:26163211-26163233 CAGCCTCTGTGTCAGGAGGAGGG - Intergenic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183927175 22:41214569-41214591 GTGGCTCTGTAGGAGGAGAATGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184346211 22:43914864-43914886 CTGCCTCTGTAGAAGACCCAAGG + Intergenic
1184374611 22:44103762-44103784 CTGGCTCTGAAGATGGAAGAAGG + Intronic
1184428237 22:44425561-44425583 CAGCCTCTGTCGATGGATGAAGG + Intergenic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184558189 22:45244975-45244997 CTGGCACTGAAGAGGGAGGAAGG + Intergenic
1185020176 22:48369890-48369912 CTGCCTCTTGGGAAGGTGGAGGG + Intergenic
1185034849 22:48468397-48468419 CTGCCTCTGCAGAGGGTGAATGG + Intergenic
1185181256 22:49364649-49364671 CTGGCTTTGGAGATGGAGGAGGG + Intergenic
949401396 3:3668681-3668703 ATGACTTTGAAGAAGGAGGAAGG - Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
949739455 3:7213764-7213786 CTGCCCCTGGAGACGGAGCATGG + Intronic
950860405 3:16142830-16142852 CTGCCTCAGTGGAAGCACGAAGG - Intergenic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
953126871 3:40099132-40099154 CTGCCTATGTAGAAGGGAGGGGG + Intronic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953392980 3:42544638-42544660 CTGCCTCTGCAGAAGCAGCCTGG + Intergenic
953634216 3:44648780-44648802 CTGGCTCTGCAGCAGGAGGCTGG - Exonic
954148396 3:48645639-48645661 CTGTCTCTGTAGAGGCTGGAGGG - Exonic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954662790 3:52234959-52234981 CTGCCTCTGTGGGTGGGGGAAGG - Intronic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
955203702 3:56876179-56876201 CTGCATGTGTAAAAGGTGGAAGG + Intronic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
955435926 3:58899107-58899129 CTGCACCTGTAGGAGGAGGCTGG + Intronic
955463209 3:59208369-59208391 CTGCCTTTGAAGATGAAGGAAGG + Intergenic
955532978 3:59893604-59893626 CTGCCTTTGTAAAAGGAAAAAGG + Intronic
955976915 3:64488761-64488783 CTTCCTCTGTAAAAGCAGCATGG + Intergenic
957828733 3:85487459-85487481 CTGCATCTGAAGAAGAAGAAAGG + Intronic
958644712 3:96855082-96855104 CTGGCTCTGAAGAGAGAGGAAGG - Intronic
958680217 3:97320547-97320569 ATTTCTCTGTGGAAGGAGGAAGG - Intronic
959191032 3:103112114-103112136 TTGACTCTGAAGAAGGAAGAAGG + Intergenic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959527598 3:107394946-107394968 CTGCCTCTGTCAAAGCAGGGAGG - Intergenic
959585793 3:108023953-108023975 CTGGCTCTGAAGATGGAAGAAGG + Intergenic
960384204 3:117001234-117001256 CTAGCTCTGTAGAAGGAAAAGGG + Intronic
961078367 3:124002995-124003017 CTCCCTCTGCTGAAGGAGGTGGG - Intergenic
961305155 3:125953782-125953804 CTCCCTCTGCTGAAGGAGGGCGG + Intergenic
961473563 3:127133620-127133642 CTGGCTTTGAAGAAGGAGGCAGG - Intergenic
961578143 3:127855423-127855445 CTGGCTCTGAAGATGGAGGGAGG - Intergenic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962044544 3:131741767-131741789 CAGCCTCTGCAGTAGGAGGCTGG - Intronic
962368003 3:134798324-134798346 CTGCCTGGGTGGAAGGAGGGAGG + Intronic
962475335 3:135750374-135750396 CTCCCTCTGTTGAGGGAGGCAGG - Intergenic
962505151 3:136039218-136039240 TTTCCTCTGTAGAATGATGAGGG + Intronic
963008289 3:140746834-140746856 CTGGCTTTGAAGAAGGAGGGAGG - Intergenic
963012695 3:140787785-140787807 AGGCCTCTGGAGAAAGAGGAAGG - Intergenic
963308621 3:143682763-143682785 CTGACTTTGAAGATGGAGGAAGG - Intronic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
965440666 3:168709436-168709458 CTGCCCATGTAGAGGCAGGAAGG + Intergenic
965633398 3:170756368-170756390 CTACCTCTGTAAAATAAGGAGGG - Intronic
965856335 3:173092556-173092578 CTGGCTTTGAAGACGGAGGAAGG + Intronic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
966923392 3:184629163-184629185 CTGCCTGGGTGTAAGGAGGAGGG - Intronic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967824220 3:193865874-193865896 CTGCCACTGTGGAAGCAGGAGGG - Intergenic
967980521 3:195062495-195062517 ATGCCGCTGTGGAAGGAGGCTGG - Intergenic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
969049853 4:4365038-4365060 CTGCCTTTGAAGATGGAGGAAGG - Intronic
969842220 4:9891030-9891052 TTGCCTCTGAAGGAGGAGAAGGG - Intronic
970398251 4:15692896-15692918 CTGGCTCTGAAGATGCAGGAAGG - Intronic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971323359 4:25623307-25623329 CAGCCTCTGGAGGAGGAGGAGGG - Intergenic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
972247915 4:37265593-37265615 CTGGCACTGAAGATGGAGGAAGG - Intronic
972261930 4:37417492-37417514 TTGCATCTTTGGAAGGAGGAGGG + Intronic
973628771 4:52798777-52798799 CTGACTTTGAAGATGGAGGATGG + Intergenic
975515158 4:75239357-75239379 TGGTCTCTGTAGAAAGAGGAGGG - Intergenic
975972317 4:80055215-80055237 TTGCCTATGGAGAATGAGGAGGG + Exonic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
978231087 4:106400909-106400931 CTGCCTATGAAGAAGATGGATGG + Intergenic
978298691 4:107239747-107239769 CTGGCTTTGTAGAATGAAGAAGG - Intronic
978661039 4:111126619-111126641 CTGACTTTGAAGATGGAGGAAGG + Intergenic
978837922 4:113175786-113175808 GTGACTCTGAAGAAGAAGGAGGG - Intronic
978928642 4:114283195-114283217 CTGACTTTGTAGCTGGAGGAAGG - Intergenic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
979674940 4:123399433-123399455 CTCTCTCTGTGGTAGGAGGAGGG - Intronic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
983766064 4:171486245-171486267 TTGCCTCTGCTGATGGAGGATGG + Intergenic
984512510 4:180695681-180695703 CTTCTTCTGTAGTAAGAGGAGGG - Intergenic
1202760601 4_GL000008v2_random:106272-106294 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
985914458 5:2906930-2906952 CTGTCTCTGCAGAAAGATGATGG - Intergenic
985925439 5:3012542-3012564 CTGTGTCTGTAGAATCAGGATGG - Intergenic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987239026 5:15973488-15973510 CTGGCTTTGGAGATGGAGGAAGG + Intergenic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
989108977 5:37889078-37889100 CTGCCTCTGGAGATGGAGGGAGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989527341 5:42468483-42468505 CTGGCTCTGCAGCAGGAGGCTGG + Intronic
990449991 5:55924960-55924982 CTGGCTCCGCAGACGGAGGAAGG - Intergenic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
991148098 5:63331128-63331150 CTGGCTTTGTAGAATGAGTAAGG + Intergenic
991598748 5:68331520-68331542 TTGCCTTTGAAGATGGAGGAAGG + Intergenic
991985268 5:72278565-72278587 CTACCTATGAAGAAGCAGGATGG - Intronic
992009029 5:72509037-72509059 CTGCCTTTGTAGAAATGGGAAGG + Intergenic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
993182432 5:84571480-84571502 CTGCCTCTGTACAATGAGGTTGG - Intergenic
994269514 5:97760389-97760411 CTGCCTCAGTAGTGGGAGAAAGG + Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996305292 5:122039346-122039368 TTGCCTCTGTTGAGGAAGGAGGG + Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
997354013 5:133250796-133250818 CAGCATCTGTGGAAGAAGGAGGG - Intronic
998068672 5:139179508-139179530 CTGCTTCTGTAGAGGGAAAATGG - Intronic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001244186 5:170093528-170093550 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1001568408 5:172714991-172715013 AGGCCTCGGGAGAAGGAGGAGGG - Intergenic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1003068011 6:2919683-2919705 CTGCCAGTGAAGAAGGAAGATGG + Intergenic
1003133135 6:3412826-3412848 CTGGCTCTGAAGACGGAGGATGG + Intronic
1003618093 6:7673242-7673264 CTGCCCCTGTGGGAGGAGGGTGG + Intergenic
1003806474 6:9730643-9730665 CAGCCTCTATAGTTGGAGGAGGG - Intronic
1004384358 6:15159631-15159653 TTGCCTGGGTAGATGGAGGATGG - Intergenic
1005347429 6:24904347-24904369 CTGACTTTGAAGATGGAGGAAGG - Intronic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1005987043 6:30882074-30882096 CTGCCTCTGGAGGAGCAGGCTGG - Intronic
1006785960 6:36667450-36667472 CTGCCACTGAACAGGGAGGAGGG - Intergenic
1006831167 6:36969129-36969151 CTGCCTGTGTTGAAGCAGAAGGG + Intronic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1008669098 6:53748347-53748369 CTGCCTTTGAAGACAGAGGAAGG + Intergenic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1009785501 6:68333138-68333160 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011507556 6:88063531-88063553 TTGCCTCTGGAGGATGAGGAAGG + Intronic
1013432449 6:110066985-110067007 CTGCCTCTGTATAAGGATGTTGG - Intergenic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014206608 6:118662798-118662820 TTGTCTCTGTAGAGGGAGGGAGG + Intronic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1014801477 6:125783015-125783037 CTGCCTTTGAAAAGGGAGGAAGG + Intronic
1014801714 6:125786125-125786147 CTGCCTCTTTAGTTGCAGGATGG + Intronic
1014820395 6:125982795-125982817 CTGCCTGAGGAAAAGGAGGATGG - Intergenic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1015275289 6:131377747-131377769 CTGGCTTTGAAGAAGGAGAAAGG - Intergenic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1018625512 6:165774670-165774692 CTGCTTCTGGAGAGGGAGGAAGG + Intronic
1018719676 6:166563219-166563241 GTGTCTCTGGAGAAGGAAGATGG + Intronic
1019501413 7:1366701-1366723 CTTCCTCTGTAGAATGGGGTGGG - Intergenic
1020246572 7:6434024-6434046 CAGCCTCCGTAGAGGGAAGAGGG - Intronic
1020678135 7:11204127-11204149 CTACCTCTGTAAAATGGGGACGG + Intergenic
1020777257 7:12470586-12470608 CTGCCTCTGAAGACTGAGGCAGG + Intergenic
1021183187 7:17532564-17532586 TTGCCTCTGTTCAATGAGGACGG + Intergenic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1024198983 7:47087786-47087808 CAACTTCTGTAGAAGGAGGTAGG + Intergenic
1024264874 7:47598796-47598818 CTGAAGCTGTAGAAGGAGGCAGG - Intergenic
1024889252 7:54182143-54182165 CTCCCTCTTTAGAGGGAGAATGG - Intergenic
1025172417 7:56771613-56771635 CTGATTCTCAAGAAGGAGGAAGG + Intergenic
1025946715 7:66110327-66110349 CTGCCTTTGAAGATGGAGGAAGG - Intronic
1026214897 7:68339815-68339837 CTGCCCCAGTAGTAAGAGGAAGG + Intergenic
1026645155 7:72161075-72161097 CTGACTCTGTAGAAGGGACATGG - Intronic
1027215961 7:76184129-76184151 CTAGCTCTGAAGATGGAGGAGGG + Intergenic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1028305379 7:89256800-89256822 TTTCCTCTGGAGGAGGAGGATGG + Intronic
1028491785 7:91420779-91420801 CTGCCTCGGTGGCAAGAGGATGG - Intergenic
1028715645 7:93964275-93964297 CAGGCACTGTAGAAGGGGGAAGG - Intronic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1030253911 7:107484900-107484922 CAGACTGTGTAGAAAGAGGAGGG + Intronic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1030629100 7:111875658-111875680 CTGACTTTGAAGATGGAGGAAGG + Intronic
1030867473 7:114717232-114717254 TTCCCTCTGTAATAGGAGGAAGG + Intergenic
1030926682 7:115465784-115465806 CTTTCTCTGTAAAACGAGGATGG - Intergenic
1031540105 7:122985163-122985185 CTTCCTCTCTTGAAGGAGGTTGG - Intergenic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1031905694 7:127457874-127457896 CTGCCTCTCAAGTAGAAGGAAGG - Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032837504 7:135687689-135687711 CTGCCTCTGTCCAATGAGCAAGG - Intronic
1033049825 7:137994085-137994107 CTGCCCCTGTGGAATCAGGATGG - Intronic
1033395090 7:140966180-140966202 TTGCCTCTGGAGAAGGAAGGGGG - Intergenic
1034421301 7:150992464-150992486 CTGCCCCTGTCTCAGGAGGAGGG - Intronic
1034562383 7:151889459-151889481 CAGCCTCTGCAGAAGAAGTAGGG + Intergenic
1034969625 7:155410943-155410965 CTGCCTGTGAAGATGGAGGAAGG - Intergenic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1037396788 8:18451884-18451906 CTGGCTTTGGAGAATGAGGAAGG - Intergenic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1037896269 8:22658542-22658564 CTGCCTCTGCAGAGGGAGTGAGG - Intronic
1037908095 8:22727298-22727320 CTCTCTCTGCAGGAGGAGGATGG + Intronic
1038039228 8:23709988-23710010 CTGGCGCTGAAGTAGGAGGAGGG - Intergenic
1039557688 8:38488416-38488438 TGACCTCTGTAGGAGGAGGAAGG + Intergenic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1040767811 8:50936689-50936711 CTGCCTTTGTAGAATGAATAGGG - Intergenic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041809812 8:61895547-61895569 CTGCCTCTGTAGCAGTTGGGAGG + Intergenic
1042366924 8:67947814-67947836 CTGACTTTGAAGATGGAGGAAGG - Intergenic
1042652482 8:71058447-71058469 CTGGCTCTGTAGATGGAGAGTGG - Intergenic
1042725260 8:71868372-71868394 TTGCCTCTGGCGAAGGAGCAGGG + Intronic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1042810771 8:72823040-72823062 CTGGCTCCTAAGAAGGAGGAAGG + Intronic
1042875508 8:73437393-73437415 CTGGCTCTGTACTTGGAGGAAGG + Intronic
1042985658 8:74580279-74580301 CTGGCTCTGAAGATGGAGGGGGG - Intergenic
1044802863 8:95975061-95975083 CTGCCTTTGGAGATGGAGGAGGG + Intergenic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046501620 8:115085088-115085110 CTGACTTTGAAGAAGGAGAAAGG + Intergenic
1046621570 8:116533990-116534012 CTGCTTGTGTGGAAGGAGGAGGG + Intergenic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1046971314 8:120226610-120226632 CTTCCTCTGTAAACCGAGGAAGG - Exonic
1047298870 8:123596002-123596024 CAGCCAGTGAAGAAGGAGGAGGG + Intergenic
1047861652 8:128973492-128973514 CTGCCTCCAAAGAATGAGGAAGG - Intergenic
1048447904 8:134505660-134505682 CTGGCTCTGGGGATGGAGGAAGG + Intronic
1048489628 8:134880609-134880631 CTGGCTTTGAAGACGGAGGAAGG + Intergenic
1048590229 8:135814497-135814519 CTGCATCTGTAAAATGATGATGG - Intergenic
1049410469 8:142471755-142471777 CCGCCTCTGTGGCGGGAGGAAGG + Intronic
1049414178 8:142487894-142487916 CTCCCTCTGTAGAAGGGGGATGG - Intronic
1049663858 8:143834270-143834292 CTAGCTCTGAAGATGGAGGAGGG + Exonic
1050429752 9:5550626-5550648 CTGCCTCTGAAGATAGAGGGAGG - Intronic
1051344790 9:16141970-16141992 CTGGCTCTGTCAAAGGAGGGTGG + Intergenic
1051575909 9:18615307-18615329 CTGCCTGTGTGGCAGGGGGAGGG + Intronic
1051880455 9:21834581-21834603 CTGGCTCTGAAGATGGATGAGGG - Intronic
1051925823 9:22323559-22323581 CTGCCTTTGAAGGTGGAGGAAGG - Intergenic
1051975080 9:22939308-22939330 CTGACTCTGAAGATGGAGAAAGG + Intergenic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1053594810 9:39548973-39548995 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1053852595 9:42304006-42304028 CTGACTGTGAAGATGGAGGAAGG + Intergenic
1054571443 9:66815994-66816016 CTGACTGTGAAGATGGAGGAAGG - Intergenic
1055058964 9:72049253-72049275 CTGACTTTGAAGAGGGAGGAGGG - Intergenic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1055440491 9:76331762-76331784 CTGCCTTTGAAGACAGAGGAAGG + Intronic
1056791748 9:89630240-89630262 CTGCTTCTGGAAAAGGAGGAGGG - Intergenic
1057287102 9:93765533-93765555 CTGCCTCAGTAGCAGCAGGCAGG - Intergenic
1057345445 9:94246753-94246775 TTGACACTGTGGAAGGAGGAGGG - Intergenic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1058286770 9:103188446-103188468 CTGCCTAATTAGAAGGAGGCAGG - Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1058766499 9:108187359-108187381 AATCCTCTGTACAAGGAGGAAGG + Intergenic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1059670235 9:116484311-116484333 CTACCTCTGGAAAAGGAGGCTGG - Intronic
1060046252 9:120343625-120343647 CTGGCTCTGAAGATGGAAGAAGG - Intergenic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060187998 9:121575611-121575633 CTGCCTCTTTGGAATAAGGAGGG - Intronic
1060776284 9:126377031-126377053 CTGGCACTGCAGAAGGCGGAGGG - Intronic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061417328 9:130454205-130454227 CTGTCTCTGTAGCAGGGGGTGGG + Intronic
1061641378 9:131959507-131959529 GGCCCTCTGTACAAGGAGGAGGG - Intronic
1061743338 9:132722917-132722939 TTGCCTCCGTGGAAGGAGGCAGG + Intergenic
1061825742 9:133257184-133257206 CAGCCTCTGGAGAAGGAGCTGGG + Intronic
1062263201 9:135673582-135673604 CTGCCTCTGTAGCTGGGGGCGGG - Intergenic
1062292982 9:135805688-135805710 CTTCCTCTATTGAAGGAGCAAGG + Intergenic
1062586581 9:137252420-137252442 CGCCCTCTGTAGTTGGAGGATGG - Exonic
1203751010 Un_GL000218v1:80294-80316 CTGTCTCTGTAGTAGTTGGATGG - Intergenic
1203482976 Un_GL000224v1:24049-24071 CTGTCTCTGTAGTAGTTGGATGG + Intergenic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1203541370 Un_KI270743v1:91158-91180 TTGTCTCTGTAGAAGTTGGATGG + Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1187446931 X:19368671-19368693 CTGCCCCTGCAGAAGTAGCAGGG - Intronic
1187859092 X:23664732-23664754 CTCCCTCAGCAGAAGGAGGCTGG + Intronic
1188434466 X:30145150-30145172 CTGACTTTGAAGACGGAGGAAGG + Intergenic
1188638510 X:32466731-32466753 CTGACTTTGAAGATGGAGGATGG + Intronic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189116744 X:38350716-38350738 CTGCATCTGTAGCATTAGGAGGG + Intronic
1189191862 X:39116338-39116360 GTGCCTCTGGAGAAGAAGCATGG - Intergenic
1190054656 X:47174636-47174658 CTGCCTCCAAAGAAGGAGGGAGG - Intronic
1190791630 X:53706064-53706086 CTGACTTTGAAGATGGAGGAGGG + Intergenic
1191009447 X:55745544-55745566 CAGCCTGTGTAGAAGAAAGATGG - Intronic
1191882644 X:65857937-65857959 TTGCCTCTGAAGATGAAGGAAGG - Intergenic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1192341357 X:70266242-70266264 CTGGCTTTGAAGACGGAGGAAGG - Intergenic
1192531276 X:71888850-71888872 TTGGCTTTGAAGAAGGAGGAAGG + Intergenic
1192574834 X:72235301-72235323 CTGGCTCGGTAGATGGGGGAAGG - Intronic
1196411732 X:115426881-115426903 TTGCCTCTGTAGATAGAGGCAGG + Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1201164663 Y:11197917-11197939 CTGTCTCTGTAGTAGTTGGATGG - Intergenic