ID: 1037890210

View in Genome Browser
Species Human (GRCh38)
Location 8:22620092-22620114
Sequence GGGGCTGCTTAGCCCCAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 281}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037890210_1037890212 -10 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890212 8:22620105-22620127 AAGCAGCCCCCTCCTCCGGATGG 0: 1
1: 1
2: 0
3: 14
4: 171
1037890210_1037890220 6 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890220 8:22620121-22620143 CGGATGGCACAGGCTCTGCTAGG 0: 1
1: 0
2: 1
3: 8
4: 175
1037890210_1037890225 28 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890225 8:22620143-22620165 GTTCCGGACACAGGCTTCTGGGG 0: 1
1: 1
2: 1
3: 8
4: 89
1037890210_1037890214 -4 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890214 8:22620111-22620133 CCCCCTCCTCCGGATGGCACAGG 0: 1
1: 0
2: 2
3: 11
4: 155
1037890210_1037890221 12 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890221 8:22620127-22620149 GCACAGGCTCTGCTAGGTTCCGG 0: 1
1: 0
2: 0
3: 12
4: 169
1037890210_1037890226 29 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890226 8:22620144-22620166 TTCCGGACACAGGCTTCTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 102
1037890210_1037890224 27 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890224 8:22620142-22620164 GGTTCCGGACACAGGCTTCTGGG 0: 1
1: 1
2: 0
3: 6
4: 102
1037890210_1037890222 19 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890222 8:22620134-22620156 CTCTGCTAGGTTCCGGACACAGG 0: 1
1: 0
2: 0
3: 5
4: 84
1037890210_1037890223 26 Left 1037890210 8:22620092-22620114 CCTGGCTGGGGCTAAGCAGCCCC 0: 1
1: 0
2: 3
3: 42
4: 281
Right 1037890223 8:22620141-22620163 AGGTTCCGGACACAGGCTTCTGG 0: 1
1: 0
2: 1
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037890210 Original CRISPR GGGGCTGCTTAGCCCCAGCC AGG (reversed) Exonic
900089797 1:915062-915084 GGGGCTGAGGTGCCCCAGCCTGG - Intergenic
900390904 1:2433380-2433402 GGGGCTGCTGAGGCCCATCCGGG + Intronic
900888104 1:5429720-5429742 GGGTCTGCTGAGGCCGAGCCAGG + Intergenic
901261377 1:7874399-7874421 GGGGCTGTTGAGCCCCAGGGCGG - Intergenic
901644589 1:10709711-10709733 GGCACTGCTCAGCCCCTGCCTGG - Intronic
901837820 1:11935443-11935465 TGGTCTGCTTAGCCCCTGCCAGG + Intronic
902181182 1:14689749-14689771 GGGGCTGCTTAGACCCTGGCAGG + Intronic
902769267 1:18636386-18636408 TGGGCTGCGAGGCCCCAGCCCGG + Intronic
903306602 1:22417387-22417409 GGGGCTGCTTACCACCTACCAGG - Intergenic
904437737 1:30509661-30509683 GGGGCTGCTTCATCCCAGGCTGG + Intergenic
904837651 1:33349622-33349644 GGGGCTGCGTAGGCCCCGCCCGG - Intronic
905173801 1:36124468-36124490 GGGGATGCTGAGCCCCTGACAGG + Intronic
905224676 1:36471559-36471581 GGGGCAGGATGGCCCCAGCCTGG + Exonic
905297653 1:36964308-36964330 GGGGCCCCTGAGCCCCAGCCTGG + Intronic
905519812 1:38589156-38589178 GGGGCTCCTGATTCCCAGCCAGG - Intergenic
905621818 1:39454911-39454933 GGTGCTGCTTAGCCCATGTCAGG - Exonic
905629512 1:39510923-39510945 GGGCCTGCTGAGCACCAGCCAGG + Intronic
905825476 1:41023238-41023260 GGGGCTGCTTATCCCCCCACTGG - Intergenic
905887962 1:41501882-41501904 GGGGCTGGGCAGCCCCAGCTGGG - Intergenic
906689440 1:47782901-47782923 GGGGCTGCTGAGCCGTGGCCAGG - Intronic
908154118 1:61335063-61335085 GGGGTTGCTTAGCCAGTGCCTGG + Intronic
910839181 1:91545694-91545716 GGGGCAGCATAGCCAAAGCCCGG - Intergenic
910935659 1:92483557-92483579 GGGCTTGCTCAGCCCCAGCCCGG + Exonic
912558526 1:110533644-110533666 AGAGCAGCTGAGCCCCAGCCAGG - Intergenic
913220959 1:116660023-116660045 ACTGCTGCTGAGCCCCAGCCTGG - Intronic
913531860 1:119739216-119739238 GGGCCTGCAGAGCCCAAGCCCGG - Intronic
913552156 1:119926159-119926181 GGGGCTTCTTGGCCCCAGGCTGG - Intronic
915355048 1:155250837-155250859 GGCGCTGTGTAGCACCAGCCTGG + Intronic
917586274 1:176430320-176430342 GGGAATGGTTAGACCCAGCCTGG - Intergenic
919743697 1:200995432-200995454 GGATCTGCTGAGCCCCAGACAGG + Intronic
921060217 1:211578874-211578896 GGGGCTGCTGAGGCTGAGCCGGG - Intergenic
921945038 1:220880283-220880305 GGGGCTGCAGGGCGCCAGCCCGG - Exonic
922280056 1:224114632-224114654 GGGGCTCCTTGCCCCCCGCCCGG + Intronic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
1062856564 10:782757-782779 GGCGCTGATTCGCCCCAGCCAGG + Intergenic
1064341170 10:14486973-14486995 GGGGCAGCTGAGCCCCATCATGG + Intergenic
1066379056 10:34885778-34885800 AGGGTGGCTTAGCCCCAGACTGG - Intergenic
1067768155 10:49104454-49104476 GGCTCTGCACAGCCCCAGCCTGG + Intronic
1067851361 10:49756749-49756771 GGGGCAGCTGAGGCACAGCCTGG - Intronic
1069563939 10:69451015-69451037 GGGGCCTATTAGCCCCACCCTGG + Intergenic
1069651767 10:70053983-70054005 GGCGCACCTCAGCCCCAGCCCGG + Intronic
1070284135 10:75071360-75071382 GAGGCTGCTCACCCCCACCCTGG + Intergenic
1071299716 10:84247541-84247563 GGGGCTGCTGAGGCCCAGCTGGG - Intronic
1071509879 10:86254839-86254861 CCGGCTGCACAGCCCCAGCCAGG + Intronic
1072745896 10:97939048-97939070 GTGGCTTCTCAGCCACAGCCTGG - Intronic
1073065954 10:100759327-100759349 AGGGCTGCATAGCTCCAGCCAGG - Intronic
1073104339 10:101023646-101023668 GGGGAGGCTCAGCCCCACCCTGG - Intronic
1073209858 10:101791057-101791079 AGGGCTGCTTTCCCTCAGCCTGG - Exonic
1073276172 10:102313448-102313470 GGGGCAGCTGAGCCCCAGCAAGG - Intronic
1074137933 10:110644174-110644196 GGGGCTGCTCAGCGCCAAGCTGG - Intergenic
1075715445 10:124552613-124552635 GGGGCTGGCAGGCCCCAGCCTGG - Intronic
1075758016 10:124831579-124831601 GAGACTGCTCTGCCCCAGCCAGG - Intronic
1076439596 10:130471980-130472002 TGGGCTGCTTAACAACAGCCTGG + Intergenic
1076748524 10:132527698-132527720 GGGGCTGCATTGCCCGAGCGGGG + Intergenic
1076777880 10:132708092-132708114 GGGGCTGCTGATGCCCAGCCTGG - Intronic
1076820019 10:132933616-132933638 GTGGCTGCTGGGCCACAGCCTGG - Intronic
1076864691 10:133160866-133160888 GGGTCTGCTTACTCCCTGCCGGG + Intronic
1076888936 10:133274678-133274700 GGGGAGGCATAGCCTCAGCCAGG + Intronic
1076917319 10:133430750-133430772 GGGGCTGCGGAGCCTCAGGCTGG + Intergenic
1076937416 10:133575509-133575531 GGGGCTGCGGAGCCTCAGGCTGG + Intergenic
1077077123 11:706861-706883 GGGGCTGCAGAGGCCCTGCCAGG + Intronic
1080641708 11:34162288-34162310 GGGGCAGCGAAGCTCCAGCCAGG + Intronic
1083306849 11:61765923-61765945 GGGGCGGCTCAGCTCCAGCCAGG - Intronic
1083756076 11:64792301-64792323 GGGGCAGCGCAGGCCCAGCCCGG - Intronic
1084736477 11:71108676-71108698 GGGGCTGCTCAGCTGTAGCCAGG + Intronic
1084961427 11:72718686-72718708 GGGGTTGGTTCACCCCAGCCTGG + Intronic
1085272183 11:75276981-75277003 GGGGCTGAATATCCCCAACCCGG - Intronic
1085297296 11:75438382-75438404 GGGTCTGCTCAGACACAGCCAGG - Intronic
1085731260 11:79001365-79001387 GGGGCTACTGAGCACCAGCCTGG + Intronic
1088903063 11:114133314-114133336 GGTGCTGGTCAGCCCCAGCAGGG + Intronic
1088912843 11:114205072-114205094 GGAGCTGATGAGCCCCAACCAGG + Intronic
1091190267 11:133687877-133687899 GGGGCTGCTGCTGCCCAGCCTGG - Intergenic
1091589382 12:1834431-1834453 GAGCCTGCTAAGCCCAAGCCCGG + Exonic
1098751086 12:74293655-74293677 GGGGCTGCTCTTCTCCAGCCAGG + Intergenic
1100224662 12:92544125-92544147 GGCACTGCTTTGCCCCAGACTGG + Intergenic
1101435612 12:104661533-104661555 GGCGCTGCTGAACTCCAGCCTGG + Intronic
1102846570 12:116191372-116191394 TGGGCTGCTTCACTCCAGCCTGG - Intronic
1103560212 12:121789658-121789680 GGGGCTGGGCAGCCCCAGCTGGG + Intronic
1103723975 12:122988899-122988921 GGGGCTGTATAGCCCCAGACAGG + Intronic
1104638423 12:130452007-130452029 GGGGCTGCTGAGCCCTGTCCTGG + Intronic
1105242615 13:18621274-18621296 GGGGGTGCATAGCCCCTGCCAGG - Intergenic
1106284087 13:28303928-28303950 GGTGCTGCTTATCACCAGCAAGG + Intronic
1108503310 13:51087281-51087303 GTGGCTGCCCAGACCCAGCCTGG - Intergenic
1112503574 13:99959823-99959845 GGGCCCGCAGAGCCCCAGCCCGG + Intergenic
1114170047 14:20263021-20263043 GGGGCTGCTGACACACAGCCAGG + Intronic
1114498865 14:23153514-23153536 GACACTGGTTAGCCCCAGCCTGG + Intronic
1114635852 14:24186375-24186397 GTGGCTGCTGAGCCCCCACCAGG - Exonic
1114666723 14:24381877-24381899 GGGGCTGCTTGGGAACAGCCTGG - Intergenic
1120169664 14:81236159-81236181 GGGCCTGCTGAGCCCGTGCCCGG - Intergenic
1121102421 14:91259109-91259131 AGAGCTGAATAGCCCCAGCCTGG - Intergenic
1121427714 14:93864553-93864575 TGTGCTGCTTAGCCCCCGTCTGG - Intergenic
1122022670 14:98851938-98851960 GGAGCCACTTAGCACCAGCCAGG - Intergenic
1122440951 14:101731501-101731523 GGGGCTGGCCAGCCTCAGCCAGG + Intronic
1123197057 14:106627156-106627178 GGTGCTGCTCAGCGCCAGCAGGG - Intergenic
1123488683 15:20763333-20763355 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1123545179 15:21332406-21332428 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1128724020 15:69974694-69974716 AGGTCTGCTGATCCCCAGCCCGG + Intergenic
1129112235 15:73344176-73344198 GGGGCAGCCTAGCCTGAGCCTGG - Intronic
1129598681 15:76984444-76984466 TGGGCTGCTTCCTCCCAGCCTGG + Intergenic
1130039448 15:80393711-80393733 GGGGCTGCTCAGCATCACCCTGG + Intronic
1130944671 15:88541927-88541949 GGGGCTGCTTCCTCCCAGCGCGG - Intronic
1202953525 15_KI270727v1_random:59677-59699 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1133770788 16:8866488-8866510 AGCGCAGCTGAGCCCCAGCCTGG + Intronic
1134230540 16:12425735-12425757 GGGTCTGCTCTTCCCCAGCCAGG + Intronic
1136128918 16:28206502-28206524 TGTGCTGCTGCGCCCCAGCCTGG + Intronic
1138105981 16:54287287-54287309 GGGGCTGCCTCGCCCCCGCAAGG - Intergenic
1138292685 16:55861411-55861433 GGAGCTGCTGACCCTCAGCCAGG - Exonic
1138358205 16:56402510-56402532 GGCGTGGCTTAGCCCCAGCTTGG + Intronic
1138554276 16:57762851-57762873 GGGGCACCTGAGGCCCAGCCAGG - Intronic
1138605887 16:58088439-58088461 GGGGCTCTGTAGCCCAAGCCTGG - Intergenic
1139885474 16:70204771-70204793 GGGGGTGGTCAGCCCCTGCCTGG + Intergenic
1139956733 16:70696862-70696884 GGGACTGAGTAGGCCCAGCCCGG - Intronic
1140481989 16:75266866-75266888 GAGGCTGGTTTGCCGCAGCCCGG + Intronic
1140512694 16:75519547-75519569 GGTGCTCCTTAACTCCAGCCTGG + Intergenic
1141228917 16:82146060-82146082 GGGTTTGCTCAGTCCCAGCCCGG + Intergenic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1142130645 16:88430217-88430239 GGGGCTGCCCAGCCCGAGGCAGG + Exonic
1142865470 17:2788566-2788588 GGGATTACTGAGCCCCAGCCAGG + Intronic
1143109822 17:4546817-4546839 TGGGCTGCTTTGTCCCACCCTGG - Intronic
1143543454 17:7582875-7582897 GGGGCTGCTGGGGCCCTGCCAGG - Intergenic
1144872430 17:18379440-18379462 GGGGCACCTGAGCCCCACCCAGG + Intronic
1145010120 17:19363142-19363164 GACGCTGCTTGGCCCCAGCTGGG - Intronic
1145980315 17:29007228-29007250 GGGGCTCCTCAGCCCAAGCAGGG - Intronic
1146892068 17:36512657-36512679 GGGGCTGCTCAGACACTGCCAGG - Intronic
1147161598 17:38572233-38572255 CGAGTGGCTTAGCCCCAGCCCGG - Intronic
1147460380 17:40564510-40564532 TGGTCTTCTTAGCCTCAGCCTGG + Intronic
1148137528 17:45304054-45304076 TGGGCTGCTGCGCTCCAGCCTGG - Intronic
1148445320 17:47733764-47733786 GGGGCGGCGTAGCCCTCGCCCGG - Exonic
1148553472 17:48564305-48564327 GCGGCGGCGGAGCCCCAGCCTGG - Intronic
1148564430 17:48624984-48625006 GGGGCTCCCGAGCCCCAGCCCGG - Intronic
1150250217 17:63700626-63700648 GGGGCCGCAGAGACCCAGCCGGG + Intronic
1151715664 17:75829933-75829955 GGAGCCCCTTGGCCCCAGCCAGG + Intronic
1151748832 17:76025582-76025604 GGGGCACCTGAGCCCCACCCAGG - Intronic
1151954671 17:77374310-77374332 GGGGCTGCTCTGTCCAAGCCTGG + Intronic
1152526154 17:80889381-80889403 AAGGCTGCTCAGCCCCAGCCAGG + Intronic
1152654521 17:81513551-81513573 GGGGCGGGGTAGCCCCAACCCGG - Intronic
1152731877 17:81976647-81976669 TGGGCAGCTGAGCCCTAGCCAGG + Intergenic
1152913410 17:83018882-83018904 GGAGCTGTTTCTCCCCAGCCAGG + Intronic
1153601009 18:6781387-6781409 GGGGATCCTTATCTCCAGCCAGG + Intronic
1154446325 18:14438603-14438625 GGGGGTGCATAGCCCCTGCCAGG + Intergenic
1157699416 18:49751530-49751552 GGGGCTGCTGAGCCCTACCGGGG - Intergenic
1158633144 18:59133481-59133503 CAGGCTGCTTAGCACCAGGCTGG + Intergenic
1159151469 18:64528848-64528870 GGGACTGCTCCGCCCCAGCGCGG - Intergenic
1159915222 18:74182468-74182490 TGGGCTGCTGAGCCTCAGCTCGG + Intergenic
1160515768 18:79478459-79478481 GGGGCTGCATAGACCCGGCTGGG + Intronic
1160584421 18:79904491-79904513 GGGCTTGCAGAGCCCCAGCCAGG - Intronic
1160779399 19:871164-871186 CCAGCTGCTTATCCCCAGCCTGG - Exonic
1160810708 19:1011838-1011860 GGGCCTGCTTGGCTCCCGCCCGG + Intronic
1160919831 19:1514098-1514120 GGGGGTGCTCAGACCGAGCCTGG - Intergenic
1161014894 19:1978660-1978682 GGAGCTGCTGGGGCCCAGCCTGG + Exonic
1161060731 19:2213556-2213578 GGAGCTGCTGAGCCGCACCCAGG - Exonic
1161678759 19:5668164-5668186 GCGGCAGCTTTGCCCCAGGCGGG + Exonic
1161722959 19:5913905-5913927 GGGGCTTCTCAGCCCGAGCCAGG - Intronic
1162016247 19:7848001-7848023 GGGTCTGCGGGGCCCCAGCCTGG + Intronic
1162794128 19:13078013-13078035 TGGGCTGCTCAGGCCTAGCCGGG - Intronic
1162800020 19:13105109-13105131 GGGGCTGCTGAGCTCCGGGCAGG - Intronic
1163182976 19:15617060-15617082 GGGGCCCCTGAGGCCCAGCCAGG + Intronic
1163575930 19:18110678-18110700 GGGGCTGCTGGGACCCAGCAGGG - Intronic
1163587040 19:18169682-18169704 TGGGCTGCGCGGCCCCAGCCTGG + Exonic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1165832822 19:38737556-38737578 GGAGGTGCTGGGCCCCAGCCCGG - Exonic
1165855880 19:38879096-38879118 GGGACAGCTGAGCCCCAACCGGG - Exonic
1166369298 19:42292419-42292441 GGGGCCGCTGGGCCCCAGCGAGG - Exonic
1167794626 19:51701554-51701576 GGGCCAGCCTAGCCCTAGCCAGG + Intergenic
1167959769 19:53096470-53096492 GGGTCTGCTGAGCCTCAGACAGG - Intronic
1167963569 19:53126311-53126333 GGGTCTGCTGAGCCTCAGACAGG - Intronic
1168269125 19:55240158-55240180 AGGGATGCCCAGCCCCAGCCCGG + Intronic
925340864 2:3134872-3134894 CGTGCTGCTTAACTCCAGCCTGG - Intergenic
925882949 2:8368273-8368295 GGTGCAGCTCTGCCCCAGCCTGG + Intergenic
926147305 2:10404603-10404625 GGGGCTGCTCAGCGCCTGCAGGG - Intronic
928071868 2:28225150-28225172 GGTGCTGCTTAGGCCAACCCGGG + Intronic
928376744 2:30781136-30781158 GGGGATTCTGAGACCCAGCCAGG + Intronic
934078493 2:88448279-88448301 GGGGCTGCTTTGCCCCCCGCTGG + Exonic
934758369 2:96839925-96839947 GGGACTGAGGAGCCCCAGCCAGG - Intronic
935027533 2:99291674-99291696 GGGGCTGCTCTGGCCCACCCAGG + Intronic
935814754 2:106837345-106837367 GGGGCTTCTTAGCACAAGTCAGG - Intronic
935953383 2:108351280-108351302 GGGGCTGTTTAGGCCAACCCTGG - Intergenic
937304890 2:120865120-120865142 GGGGCTGGGGAGCCCGAGCCAGG + Intronic
937912254 2:127081417-127081439 GGGGCTGCTGGGGCCCAGCCGGG - Intronic
938954134 2:136282855-136282877 GGGGCTGCCCAGTGCCAGCCCGG + Intergenic
938993308 2:136651790-136651812 GGATCAGCTTAGCCCCAGCCAGG - Intergenic
945396548 2:209325270-209325292 GGGGCTGCTTGGCCCCAGTGAGG - Intergenic
947257353 2:228181153-228181175 GGGGGTACTTTGCCCTAGCCCGG + Intronic
947792757 2:232877197-232877219 GGGGCTGCCGGCCCCCAGCCAGG - Intronic
948830208 2:240594926-240594948 GCTGCTGCTTAGACCCTGCCAGG + Intronic
1169345351 20:4824038-4824060 GGGCCTGTTTAGCCCCTGTCCGG - Intergenic
1169598033 20:7223024-7223046 GGGGCCACTTAACTCCAGCCTGG + Intergenic
1169792573 20:9427311-9427333 TGGGCTGCTTAGAAACAGCCAGG - Intronic
1172039174 20:32031555-32031577 ATCGCTGCTCAGCCCCAGCCCGG - Exonic
1172780769 20:37435962-37435984 GGGGCTGCTTAGCCACCCCTTGG - Intergenic
1173813392 20:45969927-45969949 GGGACTCCTAAGCCACAGCCAGG + Intronic
1173848463 20:46202728-46202750 GGGTCCCCTTTGCCCCAGCCTGG + Intronic
1174343717 20:49914750-49914772 GCGGCTGCTAAGTCCCAGCTCGG + Intronic
1174949217 20:55026224-55026246 GGGGCATCTCAGCTCCAGCCTGG - Intergenic
1175074196 20:56359450-56359472 GGGTCTGCAGAGCCTCAGCCAGG + Intronic
1175871289 20:62210659-62210681 GGGCCTGCTGAGCTGCAGCCAGG + Intergenic
1175890441 20:62313602-62313624 GGGGCTGCGGAGCCCCTCCCAGG + Intronic
1175911377 20:62406952-62406974 GGGCCTGCTCAGCCCCACGCAGG - Exonic
1176285074 21:5015191-5015213 GGGGGTGCTTAGCCGCAGAGAGG - Intergenic
1176449653 21:6851242-6851264 GGGGGTGCATAGCCCCTGCGAGG - Intergenic
1176827825 21:13716266-13716288 GGGGGTGCATAGCCCCTGCGAGG - Intergenic
1178919333 21:36728437-36728459 GGCGCTGCAAAGCCCCATCCAGG - Intronic
1179483135 21:41691260-41691282 GCATCTGTTTAGCCCCAGCCAGG - Intergenic
1179583618 21:42360933-42360955 GGGGCTCCTTCACCCCACCCAGG + Intergenic
1179872107 21:44248284-44248306 GGGGGTGCTTAGCCGCAGAGAGG + Intronic
1180157319 21:45983881-45983903 GGGTCTGCTCTGCCCCAGCCTGG - Intronic
1180223724 21:46376478-46376500 CGGGCTCCTCAGGCCCAGCCAGG - Intronic
1180822484 22:18840229-18840251 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1181014688 22:20062242-20062264 GGGTCTTCGTTGCCCCAGCCGGG + Intronic
1181190482 22:21135797-21135819 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1181208722 22:21274724-21274746 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
1181439588 22:22928905-22928927 GGCCCTGCTTAGCTGCAGCCTGG + Intergenic
1181507346 22:23368779-23368801 GGAGCTGCTGACCCTCAGCCAGG - Intergenic
1182519862 22:30879144-30879166 GGGGCTCCTTAGGCCAACCCAGG + Intronic
1183162481 22:36124117-36124139 GGCGCTGCGCAGCCGCAGCCCGG - Intergenic
1183322417 22:37173093-37173115 GAGGCTGCTCAGCCCCTCCCAGG - Intronic
1184253591 22:43274771-43274793 GGGGCTGCAGAGCCACAGCCTGG + Intronic
1184878553 22:47290781-47290803 GGGGCAGGTTAGCCCGAGGCTGG - Intergenic
1185112004 22:48905392-48905414 GGGGCTGCTTAGACAGGGCCTGG - Intergenic
1185273150 22:49937770-49937792 GGGTCTCCTTAGCCCAAGGCTGG + Intergenic
1203218216 22_KI270731v1_random:20721-20743 ACTGCTGCTGAGCCCCAGCCTGG + Intergenic
1203272623 22_KI270734v1_random:66134-66156 ACTGCTGCTGAGCCCCAGCCTGG - Intergenic
950130980 3:10546513-10546535 GGGGCTGAGTGGCCCCAGCGGGG - Intronic
950194565 3:11000054-11000076 GGGGCTGCTCTGCCCCGGCCCGG - Intronic
953980425 3:47410570-47410592 TGGGTTGCTTAGCCCCTGCAGGG - Exonic
954033836 3:47839717-47839739 GGGGCTGCTGCACTCCAGCCTGG - Intronic
954977877 3:54713776-54713798 CAGACTCCTTAGCCCCAGCCAGG - Intronic
955928560 3:64032310-64032332 AGTGCTCCTTACCCCCAGCCTGG + Intergenic
958158599 3:89787709-89787731 GCTGCTGCTCAGCTCCAGCCTGG + Intergenic
961087570 3:124082159-124082181 GGTGCTGCCAAACCCCAGCCCGG - Intronic
961192330 3:124972240-124972262 GGGACTCCTCAGCCCCAGCACGG - Intronic
961332104 3:126148449-126148471 GGAGCTGCACAGCCCCAGACTGG + Intronic
961383572 3:126511067-126511089 GGCGCTGCTTACCCCCAGGCAGG + Intronic
961671826 3:128538037-128538059 GTTTCTGCTCAGCCCCAGCCTGG + Intergenic
962452112 3:135528598-135528620 GGGGCTGCTTTTTCTCAGCCAGG - Intergenic
967977687 3:195044595-195044617 AGGACTGCTTAGGCCCAGCCAGG + Intergenic
968605689 4:1534285-1534307 GGAGCTGCCTGGGCCCAGCCAGG - Intergenic
968703214 4:2066432-2066454 CGGGCAGCTCCGCCCCAGCCTGG - Exonic
968850596 4:3075056-3075078 GCGGCTCCTCAGCCACAGCCGGG - Exonic
969054000 4:4390448-4390470 GGGGATGGTCAGCCCCAGGCGGG - Intronic
971384404 4:26129903-26129925 GGCGCTGCTGCACCCCAGCCTGG - Intergenic
973613963 4:52660706-52660728 GGGGCTGCCCAGCCTCAGGCTGG - Intergenic
977800848 4:101229338-101229360 CTGGCTTCTTAGACCCAGCCTGG - Intronic
983135564 4:164075445-164075467 GGGGCTGCATAGGACTAGCCTGG - Intronic
983941386 4:173537786-173537808 AGGGAGGCTCAGCCCCAGCCTGG + Intergenic
985966230 5:3340608-3340630 GGAGGTGCTGGGCCCCAGCCTGG + Intergenic
992574485 5:78096837-78096859 GGGGGGGCTCAGCCCCCGCCAGG + Intronic
993485607 5:88480473-88480495 TGGACTGCTCAGCCCCTGCCTGG + Intergenic
995646313 5:114316496-114316518 GGGTCTGCTTCTCCCCAGCTGGG - Intergenic
999125640 5:149243961-149243983 GGGGCTGCATAGCCCAGGGCTGG + Intronic
1000123486 5:158220596-158220618 GGGGCTGCATTGGCACAGCCTGG + Intergenic
1001406716 5:171482048-171482070 AGGGCTGTGCAGCCCCAGCCAGG + Intergenic
1001640974 5:173244117-173244139 GGGGCTGGTTCGCGCCTGCCCGG + Intergenic
1002329956 5:178434528-178434550 GGGGCAGCTGAGCCCCAGCCTGG + Intronic
1002427800 5:179186190-179186212 GGGGCTGCTGAGACCTGGCCTGG - Intronic
1002605811 5:180382059-180382081 GGGCCAGTTTGGCCCCAGCCTGG + Intergenic
1003963292 6:11229356-11229378 GGGGCCGCTGAGCCCCCGCCCGG + Intronic
1004504709 6:16238596-16238618 GGGGCTGCTGTGCCGCGGCCGGG - Exonic
1006626904 6:35404082-35404104 GGGGCTCCTTAGTCTCAGTCTGG - Intronic
1006929764 6:37680726-37680748 GGGGCTGCTGAGGCCCAGAGGGG - Intronic
1010358507 6:74965069-74965091 GGGGCTACTGAGCTCCAGGCTGG + Intergenic
1015773531 6:136792227-136792249 GGGGCTGCTCCGCGCCCGCCGGG + Exonic
1017787470 6:157768370-157768392 GGTGCTGCTGAGCCCCAGGGTGG - Intronic
1018621422 6:165732827-165732849 AGGGCTTCTCAGCCCCATCCTGG + Intronic
1019172084 6:170138272-170138294 GGATCAGCTTAGCCCCTGCCGGG - Intergenic
1019177088 6:170165473-170165495 GGGGCTGCGTGGCCCCTGCGGGG - Intergenic
1019538705 7:1541842-1541864 GGGGTTGCGGAGCCCCTGCCTGG + Exonic
1023081879 7:36533966-36533988 GGGGCGGCAGGGCCCCAGCCAGG - Intronic
1023819172 7:43970847-43970869 GGGGCTTCTTGGCCCCTGCCAGG - Intergenic
1023879882 7:44312349-44312371 GGGGCTGCAAAGCCCCAGAACGG + Intronic
1024611459 7:51068017-51068039 GCCGCTGCCTAGCCCCAGCCTGG + Intronic
1026850351 7:73719697-73719719 GCGGCTGCGCAGCGCCAGCCCGG + Intergenic
1026890078 7:73976804-73976826 GGGGCTGGGTAGTCCTAGCCAGG + Intergenic
1026979469 7:74518059-74518081 GGGGCTGCTGTGCCCCAGAGTGG - Intronic
1029114556 7:98230639-98230661 GTGGCTGCTTTGCTACAGCCTGG + Intronic
1029506035 7:100964794-100964816 GGGGCTGCAGAACGCCAGCCAGG + Exonic
1029703449 7:102262712-102262734 GGGCCAGCTGTGCCCCAGCCTGG + Intronic
1029744223 7:102507810-102507832 GGGGCTTCTTGGCCCCTGCCAGG - Intronic
1029762214 7:102606972-102606994 GGGGCTTCTTGGCCCCTGCCAGG - Intronic
1032121513 7:129160410-129160432 GCTGCTGCTTAGCACCAGCCTGG + Intronic
1032658987 7:133962482-133962504 GGGGCTACATAGCTTCAGCCCGG + Intronic
1033658305 7:143387761-143387783 GGGGCTGCTCAGCAGCAGGCAGG + Intronic
1034438535 7:151075218-151075240 GGTGCTGCTGAGGCCCAGGCTGG - Intronic
1034441353 7:151087414-151087436 GAGGCTTCTTAGCCGCTGCCCGG + Intronic
1035334140 7:158114737-158114759 GGGGCTCCCTTACCCCAGCCTGG - Intronic
1036557958 8:9876503-9876525 GGGCCAGGTGAGCCCCAGCCTGG - Intergenic
1037890210 8:22620092-22620114 GGGGCTGCTTAGCCCCAGCCAGG - Exonic
1038426484 8:27467417-27467439 GGGGCTGCTTGGCCCAATTCTGG - Intronic
1039096824 8:33895798-33895820 GGGGCTAATTAGCCCCACCCTGG - Intergenic
1039517528 8:38146183-38146205 GGGGGTGCTTAGCCCAACACAGG - Intronic
1040884228 8:52242388-52242410 GGGGCTGCTTGGTCAGAGCCTGG - Intronic
1040932056 8:52745940-52745962 GAGGCTGCTTTGAGCCAGCCTGG + Intergenic
1043883865 8:85575651-85575673 GGGGCTGATTAGGGCCAGCTGGG + Intergenic
1045326843 8:101123435-101123457 GGCGCTGCTTAGCCCCAGGCTGG + Intergenic
1047227256 8:122967440-122967462 GGGGCTGCTGGGCTCCAGGCTGG + Intronic
1048208528 8:132435099-132435121 GGGGCTGCTGTCCCCCACCCAGG - Intronic
1049247823 8:141572069-141572091 GGAGCTGCTCAGCCTCAGCGAGG + Intergenic
1049340521 8:142109886-142109908 GGTGGTGCTTAGCCCCACCAGGG - Intergenic
1049353742 8:142177645-142177667 GGGGCAGCTCAGCCGCAGACCGG + Intergenic
1049494209 8:142922186-142922208 GGGGCTGCTCGGCCTCAGGCTGG - Intergenic
1049633241 8:143671000-143671022 CGGGCTGCTGCACCCCAGCCTGG + Intergenic
1049684452 8:143933740-143933762 TGGGCTGCCTTGCCCCCGCCAGG - Intronic
1049760539 8:144330219-144330241 GGAGCTGCTGTTCCCCAGCCTGG - Intergenic
1050598076 9:7224067-7224089 GGTCCTGCTTTGCCCCAGCCTGG + Intergenic
1052306876 9:27020516-27020538 TGGGCTGCTGCACCCCAGCCTGG - Intronic
1054754730 9:68946298-68946320 GGGGCTGTGTAGCCCTAGACTGG - Intronic
1056660683 9:88540779-88540801 GGGGCTGCATGACCCCTGCCAGG - Intronic
1057210581 9:93199001-93199023 AGGCCTGCTCAGTCCCAGCCTGG + Intronic
1059329457 9:113525691-113525713 GGGGCTGATTCTCCCCTGCCAGG - Intronic
1059347058 9:113636223-113636245 GGCCCTGGTTAGCCCCTGCCTGG - Intergenic
1060966385 9:127714490-127714512 TGGGCTGCTCTGACCCAGCCGGG - Intronic
1060982986 9:127804062-127804084 GGGGCAGTTCAGCCCCACCCAGG - Intronic
1061591109 9:131598165-131598187 CAGGCTGCAAAGCCCCAGCCCGG + Intronic
1061950265 9:133932143-133932165 GGGGCTGGTTTGCCCCAGCTTGG - Intronic
1062145687 9:134988477-134988499 GCGGCTACTGAGCCCCAGCTCGG - Intergenic
1062208092 9:135348292-135348314 GGGGCTGGTGAGGACCAGCCGGG - Intergenic
1062375387 9:136259645-136259667 GGGTCTGCTCAGCCCCAGCCTGG + Intergenic
1062467640 9:136688045-136688067 GGGGCTGGGTTGCCCCACCCTGG + Intergenic
1062598484 9:137309713-137309735 GGGGGTGCTGAGGCCCAGGCGGG + Intronic
1203519532 Un_GL000213v1:33275-33297 GGGGGTGCATAGCCCCTGCGAGG + Intergenic
1191618168 X:63189782-63189804 GGGGGTGGTCAGCCCCCGCCCGG - Intergenic
1195009194 X:100718840-100718862 GGCGCTGCCTAACTCCAGCCTGG - Intronic
1198018587 X:132635984-132636006 GGGGGTGCTTAACTCCATCCAGG - Intronic
1199312091 X:146332174-146332196 GGCGCTGCTTCACTCCAGCCTGG + Intergenic
1199798630 X:151227774-151227796 AGGGCTGCTCAGCCCCAACTCGG + Intergenic
1200038279 X:153347139-153347161 GTAGCTGCGGAGCCCCAGCCCGG + Exonic
1200077469 X:153558314-153558336 GGGGCTGCCATGCCCCAGCTAGG + Intronic