ID: 1037892056

View in Genome Browser
Species Human (GRCh38)
Location 8:22628706-22628728
Sequence GAGGCTGCCACAGGCACCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 354}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037892056_1037892070 30 Left 1037892056 8:22628706-22628728 CCATGGGTGCCTGTGGCAGCCTC 0: 1
1: 0
2: 6
3: 48
4: 354
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data
1037892056_1037892061 3 Left 1037892056 8:22628706-22628728 CCATGGGTGCCTGTGGCAGCCTC 0: 1
1: 0
2: 6
3: 48
4: 354
Right 1037892061 8:22628732-22628754 GTCCGTCTCTGGGACCCCTGTGG No data
1037892056_1037892059 -7 Left 1037892056 8:22628706-22628728 CCATGGGTGCCTGTGGCAGCCTC 0: 1
1: 0
2: 6
3: 48
4: 354
Right 1037892059 8:22628722-22628744 CAGCCTCTGTGTCCGTCTCTGGG No data
1037892056_1037892058 -8 Left 1037892056 8:22628706-22628728 CCATGGGTGCCTGTGGCAGCCTC 0: 1
1: 0
2: 6
3: 48
4: 354
Right 1037892058 8:22628721-22628743 GCAGCCTCTGTGTCCGTCTCTGG No data
1037892056_1037892069 29 Left 1037892056 8:22628706-22628728 CCATGGGTGCCTGTGGCAGCCTC 0: 1
1: 0
2: 6
3: 48
4: 354
Right 1037892069 8:22628758-22628780 TGGCACAGAAAAGCCCTCTGTGG No data
1037892056_1037892063 9 Left 1037892056 8:22628706-22628728 CCATGGGTGCCTGTGGCAGCCTC 0: 1
1: 0
2: 6
3: 48
4: 354
Right 1037892063 8:22628738-22628760 CTCTGGGACCCCTGTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037892056 Original CRISPR GAGGCTGCCACAGGCACCCA TGG (reversed) Intronic
900104383 1:976115-976137 GAGACGACCACAGGCGCCCAGGG - Exonic
900166603 1:1246513-1246535 GGGGCTGCCCGAGGCCCCCAAGG - Exonic
900233856 1:1577273-1577295 GAGGCTGCCACTGCCATCAATGG - Intergenic
900386936 1:2414868-2414890 GAGGCTGCCACAGGGAGGCAAGG - Intergenic
900639172 1:3680692-3680714 GAGGCTGGCACAGGGCCCCGGGG - Intronic
901066931 1:6498648-6498670 GGGGCTGCCACAGGCACCCCGGG + Intronic
901450494 1:9333757-9333779 GAGGTTGCCAAAGAGACCCAAGG + Intronic
901860839 1:12073324-12073346 GAGGCTGGCGCAGGAACCTAAGG + Intronic
902089663 1:13893163-13893185 GAGGCTGCCCCAGGGTCCCCGGG - Intergenic
902620380 1:17647274-17647296 GAGGATGACACTGGCACTCAGGG - Intronic
902824335 1:18962647-18962669 GAAGGTGCCAAAGGCAACCAGGG - Intergenic
903225680 1:21893182-21893204 GAGGGACCCACAGGGACCCAGGG - Intronic
903350865 1:22715891-22715913 GTGTCTGACACAGGAACCCAGGG - Intronic
903759610 1:25688865-25688887 GAGCCTGCCACAGGCTCACTGGG - Intronic
904294228 1:29507321-29507343 TGGGCTGCAACAGGCACCCAGGG - Intergenic
904705841 1:32390100-32390122 GAGGTTGCCAAGGGCAACCAGGG + Intronic
905207254 1:36349936-36349958 GAGGCAGCCCAAGGCCCCCATGG - Intronic
905311115 1:37049776-37049798 GATTCTGCCCCAAGCACCCATGG - Intergenic
905878493 1:41448572-41448594 CAAGCAGCCTCAGGCACCCATGG + Intergenic
906185802 1:43861026-43861048 GAACCTGGCACAGGCACACAAGG - Intronic
906191325 1:43901245-43901267 GAGGCTGTGACAGGTGCCCATGG - Intronic
907147865 1:52252853-52252875 GAGAGTGACACAGGCACCGATGG + Intronic
907309970 1:53533647-53533669 GAGGATGCTGCAGGCACCCCTGG + Intronic
912460110 1:109824807-109824829 GGGGCTGCCACAGACCCCTAGGG + Intergenic
912545859 1:110451057-110451079 GAGGCATCCACAGGCAGCCCTGG + Intergenic
915609995 1:156984194-156984216 GAGGCTTCCCCACGCACCCATGG + Intronic
916175378 1:162033676-162033698 GAGGCTGGCACAGGCATCCCTGG + Intergenic
917739866 1:177951913-177951935 GAGGATTCCACAGGCAGCCACGG - Exonic
920089347 1:203441278-203441300 GAGGATGACACAGGGACCCAGGG - Intergenic
920166733 1:204041438-204041460 GCAGCTGCCAGAGGCCCCCAAGG - Intergenic
920295041 1:204950840-204950862 GTGGCTGGCACAGGACCCCAGGG + Intronic
921893587 1:220376860-220376882 GAGGCTGTCACAGCTATCCAAGG - Intergenic
921998960 1:221454389-221454411 CAGTTTGCCACAGGCACTCATGG + Intergenic
922723995 1:227914220-227914242 GTGGCTCTCACAGGCACCCTGGG - Intergenic
922786945 1:228287565-228287587 GTCGCTGCCACAGGCCCCAAAGG + Intronic
922922658 1:229319830-229319852 CAGGCTCCCACTGGCAGCCAGGG + Intergenic
924420710 1:243906910-243906932 GAGGCTACCACAGCCACCCCTGG - Intergenic
1062770820 10:99178-99200 GTGGTTGCCTCAGGCACACAGGG + Intergenic
1066049471 10:31620594-31620616 GAGTCTCCCATTGGCACCCAAGG - Intergenic
1066089545 10:32004159-32004181 CAGGCTGCCACTGGCAAGCAGGG + Intergenic
1070311241 10:75275643-75275665 GTGGCTGCCACAGGCAGCCTGGG + Intergenic
1070549549 10:77480330-77480352 GAGTCTGGCACAGTGACCCAGGG + Intronic
1070803111 10:79255042-79255064 AGGGCGGCCACAGGCATCCATGG - Intronic
1070916924 10:80161000-80161022 GAGGCTGCTGCAGGGACCCGGGG - Intronic
1070964212 10:80519696-80519718 GCGGCTGCCAGAGGAACCAAGGG + Exonic
1071531456 10:86392731-86392753 CAGGATGGCACTGGCACCCAGGG - Intergenic
1072335688 10:94395927-94395949 GTGGCTGCAGCGGGCACCCAGGG + Intergenic
1072754802 10:98012245-98012267 GTGTGTGCCACAGGCTCCCATGG - Intronic
1073328253 10:102654958-102654980 CAGGCTGCCCCAGGCTCCCAAGG - Intronic
1074401041 10:113141378-113141400 GAGGCCTCCACAGGAACCCCAGG + Intronic
1075717898 10:124567399-124567421 GAGGCTGAGAGAGGCAGCCAGGG - Intronic
1076003081 10:126927853-126927875 TAGGCAGCCACAGCAACCCAAGG - Intronic
1076641719 10:131921341-131921363 GGCGCTGCCCCACGCACCCAGGG + Intronic
1076897217 10:133318602-133318624 GAGACCGGCACTGGCACCCACGG - Intronic
1077336451 11:2007057-2007079 CAGGGGGCCACAGACACCCATGG - Intergenic
1077438413 11:2555994-2556016 GGGGCTGCAGCTGGCACCCAGGG - Intronic
1077550216 11:3196871-3196893 GGGGCTGCCACAGGCAGCTCGGG + Intergenic
1078621740 11:12914772-12914794 GCTGCTCCCACAGGCACCAAAGG - Intronic
1080742956 11:35082744-35082766 GTGGCAGCCACAGTCAGCCAGGG + Intergenic
1083387468 11:62322307-62322329 GAGGCTGCCAGGGTCACCCCAGG + Intergenic
1083535956 11:63466807-63466829 TGGGCTGCCACAGGGACACAGGG + Intronic
1084004208 11:66314683-66314705 GGGGCTGCACCAGGGACCCATGG - Exonic
1084294140 11:68199508-68199530 GAGGCTGCCACAGGGAAGAAGGG + Intronic
1084403959 11:68960438-68960460 GCAGCTGGCACAGACACCCATGG - Intergenic
1084544983 11:69810730-69810752 GACGCTGCCACAGTCTCCCCGGG - Intronic
1085016737 11:73178792-73178814 GTGTCGGCCACAGGTACCCAGGG - Intergenic
1085053877 11:73393063-73393085 GAGGTAGCCACAGGCTCCCATGG - Intronic
1085457740 11:76674713-76674735 GAGGCTCCCAGAGGCCCCAAGGG + Intergenic
1086892187 11:92271055-92271077 GAGGCTGCTGCAGGAACACAAGG - Intergenic
1087813245 11:102631140-102631162 GAGGCTGCCGGGGGCACCAAGGG + Intergenic
1088158823 11:106842890-106842912 GGCACTGCCACAGACACCCAAGG - Intronic
1088671370 11:112144676-112144698 CAGGCTTACACAGGAACCCAGGG - Intronic
1088884821 11:113998528-113998550 GGGGCTGCCCCAGGCACGCAGGG + Intergenic
1089338562 11:117742435-117742457 GAGGGTCCCACAGCCAGCCATGG - Intronic
1089369043 11:117941210-117941232 GAGGCTGCCCCAGGCTCCTTTGG + Intergenic
1089873439 11:121696772-121696794 GAGCATGCCACACGTACCCACGG - Intergenic
1091310651 11:134573187-134573209 GAGGCTGCCTCAGGCGGCCCAGG + Intergenic
1202819435 11_KI270721v1_random:62239-62261 CAGGGGGCCACAGACACCCATGG - Intergenic
1092131251 12:6114753-6114775 GAGGCAGCTCCAGGCAGCCAGGG + Intronic
1093546230 12:20352486-20352508 GAGTCTGGCTCAGTCACCCAGGG + Intergenic
1093587327 12:20855337-20855359 GAGGATGCCACTGGTACCTAGGG + Intronic
1093600524 12:21015938-21015960 GAGGATGCTACTGGTACCCAGGG + Intronic
1094051629 12:26226783-26226805 GAGGCTGCCGCAAGCAGCCCAGG - Intronic
1095910163 12:47418067-47418089 GAGGGTACCAGAGGCAGCCATGG + Intergenic
1096533262 12:52255136-52255158 TCTGCTGCCAGAGGCACCCAGGG + Intronic
1099710892 12:86223367-86223389 GATGCTGCCACTGCTACCCAAGG + Intronic
1099727295 12:86448198-86448220 GAAGCTGCCACAGGCAACCCAGG - Intronic
1101439579 12:104693473-104693495 GAGGCTGTCTCAGGCACACCAGG + Intronic
1102236761 12:111298611-111298633 GAGGGAGCCTCTGGCACCCACGG - Intronic
1103862767 12:124027549-124027571 GAGGCAGACACAGGCCCGCAGGG - Intronic
1103939677 12:124494996-124495018 GAGGCCGCCACAGAGACCCCTGG - Intronic
1104931929 12:132344344-132344366 GAGTCAGCCATATGCACCCATGG - Intergenic
1105702019 13:22940855-22940877 GCGCCAGCCACACGCACCCATGG - Intergenic
1106100788 13:26694134-26694156 GTGGGGGCCACAGGGACCCACGG - Intergenic
1107425462 13:40288485-40288507 GAGCCTGCCTCTGGAACCCAGGG + Intergenic
1107998855 13:45888454-45888476 GAGTCAGCCTCAGTCACCCAGGG - Intergenic
1111890853 13:94081045-94081067 GCAGCTACCACAGACACCCATGG - Intronic
1112032846 13:95473437-95473459 CAGGCTGCCTGAGGCACCCGAGG - Intronic
1112044964 13:95587402-95587424 GCGGATCCCAAAGGCACCCACGG - Intronic
1114417426 14:22554127-22554149 CAGGCCTCCACAGGCTCCCACGG - Intergenic
1117512967 14:56471556-56471578 GAGGCTGCCCCTGGGACCAAGGG - Intergenic
1118516975 14:66540972-66540994 GAGTCTCCCACTGTCACCCAGGG + Intronic
1120765691 14:88324904-88324926 TGGGCTGTCACAGGCACCCCAGG + Intronic
1122007125 14:98714812-98714834 GAGGCATCCACATGCACACATGG - Intronic
1122529805 14:102417842-102417864 GAGGCTGCCACGGGAGTCCAGGG + Intronic
1122801043 14:104229587-104229609 GCGGCCACCACAAGCACCCAGGG - Intergenic
1122960073 14:105090225-105090247 GAGGCCTCTAGAGGCACCCAGGG + Intergenic
1122988553 14:105225172-105225194 GAGGCTGTTGCAGGAACCCAGGG - Intronic
1123042930 14:105497822-105497844 GAGGCTGCAGCAGGCACCTCCGG - Exonic
1123097689 14:105774182-105774204 GAGGCAGCCACAGGTGCGCAGGG - Intergenic
1124159835 15:27258175-27258197 GAGGTGACCTCAGGCACCCATGG + Intronic
1125606587 15:40942803-40942825 GAGGTTGCCGCAGACCCCCACGG - Intergenic
1127383025 15:58445615-58445637 GAGTCTCCCTCAGGGACCCATGG - Intronic
1131132301 15:89908126-89908148 GAGGCTTCCACATCCACCCCTGG - Intronic
1131596524 15:93803615-93803637 CAGGCGGCCACCGGAACCCACGG + Intergenic
1132316977 15:100897512-100897534 GAGGCTGCCGCAGACAGGCAGGG - Intronic
1132408150 15:101557271-101557293 GAGGCTGCTTCAGGTACGCACGG - Intergenic
1132685606 16:1160809-1160831 GCGGCGGCCACACCCACCCAAGG - Intronic
1132883214 16:2171393-2171415 GAGGCCCCCACAGGACCCCAGGG + Intronic
1135413712 16:22253400-22253422 GAGGAAGCCACAGCCCCCCAGGG - Intronic
1136096701 16:27962138-27962160 GAGCCTGCCACAGGGACACGGGG - Intronic
1136277513 16:29187620-29187642 GCGCCTGCCTCAGGCACCCGGGG - Intergenic
1137037425 16:35578434-35578456 GAGGCAGCTGCAGGCACCCAGGG - Intergenic
1137636676 16:49992951-49992973 GAGGCAGCCACATTCTCCCAAGG + Intergenic
1140105132 16:71952768-71952790 GAGGCTGCCACAGTGAGCCGAGG + Intronic
1140530326 16:75660279-75660301 GGGCCTGCCACAGGAACCCAAGG - Intronic
1141040108 16:80665869-80665891 GATGTGGCAACAGGCACCCAGGG + Intronic
1141107000 16:81242130-81242152 GCGCCAGGCACAGGCACCCAGGG - Intronic
1142081891 16:88153662-88153684 GCGCCTGCCTCAGGCACCCGGGG - Intergenic
1142132711 16:88438211-88438233 GAGGCTTCCCCAGGCAGCCCCGG + Exonic
1142177846 16:88653058-88653080 GAGTCTGACACAGGCTCCCAGGG - Intronic
1142249176 16:88983308-88983330 GGGGCTGCCCCAGGGTCCCAAGG - Intergenic
1142409814 16:89910305-89910327 GAGGCTCCCACAGCCATCCTCGG - Intronic
1142607083 17:1087866-1087888 GCCGCTGCCACAGTCACCCCAGG + Intronic
1143492355 17:7291884-7291906 GTGGTTGACACAGGCACCCAAGG + Intronic
1143641282 17:8199362-8199384 CAGACTGACACAGGCAGCCAAGG - Intergenic
1144497640 17:15758516-15758538 GAGCCTCCCTCAGGAACCCAGGG - Intergenic
1144623185 17:16831343-16831365 GGGGTTGCCAGATGCACCCAGGG - Intergenic
1144629436 17:16862999-16863021 GAGCCTCCCTCAGGAACCCAGGG - Intergenic
1144707287 17:17378001-17378023 GTGGCTCCCGCAGGCAGCCAGGG - Intergenic
1144883246 17:18441373-18441395 GGGGTTGCCAGATGCACCCAGGG + Intergenic
1145148982 17:20503013-20503035 GGGGTTGCCAGATGCACCCAGGG - Intergenic
1145161009 17:20573565-20573587 GAGCCTCCCTCAGGAACCCAGGG - Intergenic
1146623651 17:34419593-34419615 GAGGCTGCCATAAAGACCCAGGG - Intergenic
1146739192 17:35266630-35266652 AAGACTGCCACAGTCCCCCAGGG + Exonic
1147263912 17:39224068-39224090 GAGTCTGGCAGAGGCACCCCAGG - Intronic
1147577504 17:41611280-41611302 GGGGTTGCCAGATGCACCCAGGG - Intronic
1148735934 17:49864890-49864912 GAGCATGCCACGGTCACCCATGG - Intergenic
1148896483 17:50842050-50842072 GTGGCGGCCTCAGGAACCCACGG + Exonic
1150433906 17:65139496-65139518 AAAGCAGCCACAGGCACCCCTGG + Intronic
1150794766 17:68228528-68228550 GAGGCTTCCGCAGCCTCCCAAGG - Intergenic
1151230805 17:72683861-72683883 CAGACTGCCAAAGGAACCCAGGG - Intronic
1151319224 17:73342673-73342695 GATGGTCCCACAGTCACCCAGGG - Intronic
1151633528 17:75327801-75327823 GAGGCTGACACACACACACAAGG - Intronic
1151906744 17:77053942-77053964 GAAGGTGCCCCAGGCACCTAAGG - Intergenic
1152432060 17:80253990-80254012 GAGGCTGCCACAGGCCTCCAGGG - Intergenic
1152487010 17:80601107-80601129 GAGGCTGCCAGAGGAGGCCATGG + Intronic
1152846189 17:82601127-82601149 GAGGCTCCCACAAGACCCCAGGG - Intronic
1153985187 18:10344766-10344788 GAGGCTGTGCTAGGCACCCAGGG + Intergenic
1154203527 18:12317719-12317741 GGGGCTGCAACAGGTCCCCAGGG - Intronic
1157497484 18:48166725-48166747 TACACTGCCACAGGCAGCCAGGG + Intronic
1157504703 18:48218173-48218195 GAGACTACCACATGTACCCAAGG - Intronic
1157688510 18:49662212-49662234 GAGGCTGCCGTAAGCTCCCAAGG + Intergenic
1157858723 18:51122888-51122910 TAGGGAGCCAGAGGCACCCATGG - Intergenic
1158485132 18:57859403-57859425 GAGGCTTCCAAAGTCACCCTGGG - Intergenic
1160070940 18:75627117-75627139 GAGGCAGCCCCAAGCGCCCATGG - Intergenic
1160559739 18:79748703-79748725 GAGGCGGCCGCAGGCGCTCATGG - Intronic
1160616706 18:80136348-80136370 GAGGCTTCCAGGGGCACCCTGGG - Exonic
1160765611 19:806255-806277 GACGACCCCACAGGCACCCAGGG + Intronic
1160869549 19:1270915-1270937 GTGTCTGCCACAGGCCGCCATGG + Exonic
1161039632 19:2103331-2103353 GAGGCAGCCAGAGGCAGCCGGGG + Intronic
1161251388 19:3282270-3282292 GAGCCTCCTCCAGGCACCCAAGG + Intronic
1161295184 19:3516165-3516187 GAGACAGCCACACGCACTCATGG - Intronic
1161856353 19:6767864-6767886 CAGGCGGCCCCAAGCACCCATGG + Intergenic
1161936486 19:7375648-7375670 GCTGCTGCCCCAGGCATCCAGGG - Intronic
1161972455 19:7590346-7590368 GGGGCTGCCCCATGCACACAGGG + Intergenic
1162046342 19:8002782-8002804 GAGGCTGCAACAGGCAGGGAGGG + Intronic
1162329948 19:10021619-10021641 CAGGCTGCCAGAGGAATCCACGG - Exonic
1162966651 19:14159378-14159400 GTGAGTGCCACAGTCACCCAGGG - Intronic
1163674049 19:18646528-18646550 GAGGGAGCCACAGTCACCCATGG - Intronic
1164478005 19:28590103-28590125 GAGACTGCCACAGCCCCACAGGG + Intergenic
1164478020 19:28590157-28590179 GAGACTGCCACAGCCCCGCAGGG + Intergenic
1164478035 19:28590211-28590233 GAGACTGCCACAGCCCCGCAGGG + Intergenic
1164478049 19:28590265-28590287 GAGACTGCCACAGCCCCGCAGGG + Intergenic
1164895702 19:31875705-31875727 GAGGCTGGCTCAGGCCCCGACGG + Intergenic
1165076238 19:33281399-33281421 GAGGCAGCCACCTGCAGCCAGGG - Intergenic
1165291904 19:34892416-34892438 GAGGCAGCTACAGGCAGCAAGGG - Intergenic
1165353893 19:35292085-35292107 CAGGCGGCCCCTGGCACCCAGGG + Intergenic
1165372963 19:35421413-35421435 GAGGCTGGCAGAGGGACCAATGG - Intergenic
1165428765 19:35759818-35759840 CAGGCTCCCACAAGCTCCCAAGG + Exonic
1165775651 19:38403109-38403131 GAGCCTGCCACCGGCCGCCAGGG + Intergenic
1165896218 19:39142764-39142786 CAGGGTGACACAGGCAGCCAAGG - Intronic
1165896223 19:39142782-39142804 GAGGCTGGGAAAGCCACCCAGGG - Intronic
1166495673 19:43301522-43301544 GAGGGAGCCAGAGACACCCATGG + Intergenic
1166678743 19:44754847-44754869 GAGGCTCCGAAAGGCCCCCATGG + Intronic
1167441909 19:49513519-49513541 GAGGCGGCCCCAGGCAGGCAGGG + Intronic
1168721330 19:58556420-58556442 GAGACTGCCACAGGCCCCTCTGG + Intronic
925044924 2:765941-765963 CAGGATGCCACAGTCACCCTCGG + Intergenic
926153266 2:10436104-10436126 GAGGCAGCCCCGAGCACCCATGG - Intergenic
926306187 2:11638935-11638957 GTGACTGCCTCAGCCACCCAGGG + Intronic
929916709 2:46142614-46142636 GTGGCTGCCACAGCCAAGCATGG - Intronic
930866564 2:56127657-56127679 GACGCTGCCACTGGGAACCATGG - Intergenic
930991898 2:57666214-57666236 GAGGCAGCCATAGACAGCCAAGG - Intergenic
933252021 2:80039291-80039313 GTGGCTGCTCCAGTCACCCAGGG - Intronic
934971260 2:98766330-98766352 GAAGCTGTCACAGGCAGGCATGG - Intergenic
935183921 2:100714801-100714823 GAGCCTGCCAAAGGCTCCGAAGG - Intergenic
935266392 2:101398380-101398402 GAGCCTGTGAAAGGCACCCACGG + Intronic
936076435 2:109404590-109404612 GAGGCTGCCACGGGCACACAGGG + Intronic
937024038 2:118682702-118682724 GAGGACACCACAGGCAGCCAAGG - Intergenic
937030821 2:118738861-118738883 GAGGCATCCACAAGCAGCCAGGG + Intergenic
937041372 2:118823290-118823312 GAATGTGCCACAGGCTCCCACGG - Intergenic
938411572 2:131069053-131069075 GTGGCCCCCACAGGCACCCAAGG + Intronic
938447247 2:131388739-131388761 GAGACTGCAAAAGGCAGCCATGG - Intergenic
939675508 2:145067096-145067118 GAGGCTCCCGCAAGGACCCATGG - Intergenic
939861174 2:147422337-147422359 GAGGCTCTCTCAGGAACCCATGG + Intergenic
940049467 2:149447256-149447278 GAGGCTGTCGCGGGCACCCAAGG - Intronic
942064743 2:172260069-172260091 GGGGCAGCCACAGGCACCTCAGG + Intergenic
942767299 2:179471797-179471819 TAGCCAGCCACAGGCATCCATGG + Intronic
946245003 2:218382466-218382488 GAGGCTTCCACAGGGGACCAAGG - Intronic
946985746 2:225271010-225271032 CAGCCTGCCACAGGCCACCAGGG - Intergenic
947529348 2:230898948-230898970 GAGGCTGCCACAGGAGGGCATGG - Intergenic
948360556 2:237417231-237417253 GAGTCTTGCAGAGGCACCCATGG - Intergenic
948484903 2:238274286-238274308 GAGGCTGCCACTTGCCCTCAGGG + Intronic
948805308 2:240451377-240451399 GCAGGGGCCACAGGCACCCAAGG - Intronic
1168971579 20:1934928-1934950 GAGGCTGCAACAGCCACTCTTGG - Intronic
1170118890 20:12891435-12891457 GAGGCTACAGCAGCCACCCAGGG + Intergenic
1170608641 20:17894006-17894028 CAGGGAGCCACAGGCACACATGG + Intergenic
1171329144 20:24322159-24322181 GAAGCAGCCACACCCACCCAGGG - Intergenic
1171396899 20:24840561-24840583 GGTGCAGCCACAGGAACCCAAGG + Intergenic
1172595920 20:36151121-36151143 GAGTCAGCCACAGACCCCCAAGG - Intronic
1173546891 20:43904470-43904492 GAGGTTGCCACAGCAACTCAGGG + Intergenic
1173554394 20:43955313-43955335 ATGGCTGCCAGAGGCCCCCATGG - Intronic
1173828403 20:46062323-46062345 GGGGCAGCCACAGGCCCCCATGG - Exonic
1174436114 20:50508296-50508318 GTGCCTGCCACAAGCACTCAAGG + Intergenic
1174448924 20:50608296-50608318 GAGGCTGGTGCAGGAACCCAGGG + Intronic
1175481158 20:59312166-59312188 GAGGCTGGGCCAGGCAGCCATGG + Intronic
1175696338 20:61105821-61105843 AAGGGAGCCACAGGCACCCCAGG + Intergenic
1175799283 20:61792018-61792040 CAGGCAGCCAAAGGCATCCAGGG - Intronic
1176023290 20:62973425-62973447 GAGGCTGGCAGGGGCAGCCACGG - Intergenic
1176140559 20:63542984-63543006 AAGGCTGCCCCAGGCCCCAAGGG - Intronic
1176285373 21:5016481-5016503 CAGGCAGCCCCAGGAACCCAGGG + Intergenic
1177705957 21:24705218-24705240 GAGGATGCCACATGCATGCAGGG + Intergenic
1178639641 21:34335658-34335680 GAGCCTGGCAGAGTCACCCAAGG - Intergenic
1178731053 21:35103147-35103169 GAGCCTCCCACAGCCAACCATGG - Intronic
1179609931 21:42543704-42543726 GAGGCAGCCACGGGCAAACAGGG - Intronic
1179871808 21:44246994-44247016 CAGGCAGCCCCAGGAACCCAGGG - Intronic
1180352973 22:11819090-11819112 GAGTCAGCCCCATGCACCCAGGG + Intergenic
1180385271 22:12173267-12173289 GAGTCAGCCCCATGCACCCAGGG - Intergenic
1180711187 22:17840853-17840875 GAGGCTGCCCCCGGCATGCACGG + Intronic
1180940292 22:19656471-19656493 GAGCCAGCCAGTGGCACCCAGGG - Intergenic
1181013090 22:20053632-20053654 GAGGCTGCCACAGCCCCCAGTGG - Intronic
1181044861 22:20209714-20209736 GAGGCTGCCACAGACCACCTGGG - Intergenic
1181150680 22:20881203-20881225 GAGGTTGCCACTGCCCCCCAAGG - Intronic
1182018466 22:27060821-27060843 GAGGCAGCCACCAGGACCCACGG - Intergenic
1182622101 22:31623909-31623931 GAGGCTGCCACCTGCACCCAGGG + Intronic
1183091592 22:35525966-35525988 GAGTCTTCCACTGTCACCCAAGG + Intergenic
1183111371 22:35651289-35651311 GAGGCTGCAAAAGGCACAGATGG - Intronic
1183248818 22:36713832-36713854 GGGGCTTCCACAGGTACCCAGGG + Intergenic
1183478430 22:38049960-38049982 GAGGCGGCCACCGAGACCCATGG + Intergenic
1183632569 22:39042124-39042146 GAGGCTGCCCTAGGCCCGCACGG - Intronic
1183976570 22:41515711-41515733 GTGGCTGGCACAGGCACACACGG + Intronic
1184486213 22:44781335-44781357 CACGCTGCCACAGCAACCCAAGG - Intronic
1184571462 22:45327634-45327656 GACGCTGCCACAGGAAAGCACGG - Intronic
1184655576 22:45940425-45940447 GAGGCTGGCACAGGCAAGCGTGG - Intronic
1184663136 22:45974725-45974747 GAGGCTGACACAGGTGCCCGGGG + Intronic
1184950062 22:47834612-47834634 GTCGCTCCCACAGGGACCCACGG + Intergenic
1185008374 22:48299254-48299276 GAGGCCGGCACAGGCTTCCAGGG - Intergenic
1185310555 22:50151921-50151943 GCGGCTGCCACAGTGACCCCAGG + Intronic
950413566 3:12855093-12855115 GAGGCTGCCAGTGGCAAGCAGGG + Intronic
950495372 3:13330799-13330821 GAGGCTTCATCAGTCACCCACGG + Intronic
952852068 3:37737564-37737586 GAAGCCCCCACAGGCACTCATGG - Intronic
953866426 3:46587047-46587069 TGGGCTGCCACTGGCACCCCAGG + Intronic
953988749 3:47467064-47467086 GAGTCTCCCTCAGTCACCCAGGG - Intronic
954327415 3:49871042-49871064 GAGGCTGCCCTGGCCACCCATGG + Intergenic
954850353 3:53594784-53594806 GTGGCTGCCACATACACACAAGG - Intronic
955640496 3:61077952-61077974 GAGGCTGCCACAATAGCCCACGG + Intronic
956556734 3:70532068-70532090 GAAGCTGCCAAAGGCACCTCTGG + Intergenic
959245812 3:103866208-103866230 GAGGCTGCCTCTGGCATCTAGGG - Intergenic
960300749 3:115999766-115999788 GAGGCTGCCTCGGGCTCTCATGG + Intronic
961511812 3:127408100-127408122 GTGGCTGTCACAGTCATCCAAGG + Intergenic
961758426 3:129146235-129146257 GAGGCTGGGATACGCACCCAGGG + Intronic
961768633 3:129231845-129231867 GAGGCTGCTTCAGGAGCCCAGGG + Intergenic
967904393 3:194488050-194488072 GAGGGCGCCACAGCCACCCCTGG + Intronic
968519399 4:1028855-1028877 GAGGCGGGCAGAGGCGCCCAGGG + Intergenic
968621208 4:1604229-1604251 GAGGCTGCCGCACCCACCCAGGG + Intergenic
969302815 4:6307266-6307288 GAGGCTGCCACAGACATCCAAGG - Intergenic
972356040 4:38280273-38280295 GAGGCTGCCACTGTCCCCAAGGG - Intergenic
972780136 4:42279983-42280005 GAGGCTGCCCCAGGCCCCACTGG - Intergenic
975621377 4:76300118-76300140 GAGATTGCCAATGGCACCCATGG + Intronic
977781546 4:100986621-100986643 GATGCTGCCACAGGGCCCTATGG + Intergenic
981723735 4:147826517-147826539 GTGGCAGCCACAGCCAACCACGG + Intronic
982337396 4:154256170-154256192 GAGTCTGGCACTGTCACCCAGGG + Intronic
982780348 4:159483860-159483882 AAGGCAGCCACAGGCAAACAGGG + Intergenic
984664279 4:182408850-182408872 GAGGCTGCCAAAGGCCCCAAGGG - Intronic
985944236 5:3164141-3164163 GAGGATGGCACAGGCCCCGAGGG - Intergenic
986408681 5:7453472-7453494 GAGGCTGCTGCAGACACACAGGG - Intronic
987076003 5:14382445-14382467 GAGGCTCACACAGGCAAGCAGGG + Intronic
987325847 5:16811212-16811234 GGGGCTGCCCCAGGCACTCCGGG + Intronic
988465204 5:31483803-31483825 GTAACTGCCACAAGCACCCAAGG + Intronic
988497287 5:31756178-31756200 GAGCCAGGCACAGGCACCCCCGG - Intronic
988501043 5:31784002-31784024 GACGCTGCCACAGGGCCTCAGGG + Intronic
992136030 5:73746768-73746790 GAGGCAGACACATGGACCCATGG - Intronic
992174304 5:74134298-74134320 GAGGCTGCTCCACTCACCCACGG + Intergenic
992533133 5:77671520-77671542 GAGGCTGCCAGACCCCCCCAGGG + Intergenic
992672846 5:79076855-79076877 ATGGCTGCCGCAGCCACCCAAGG + Intronic
993720180 5:91314514-91314536 GAGATTGCCACAGACACCCAGGG - Intergenic
993752116 5:91682981-91683003 GAGGCTCCCAGAAGCAGCCAGGG - Intergenic
993898882 5:93571140-93571162 GGGGCCGCCACAGGCACCTTAGG + Intergenic
995548392 5:113255397-113255419 AAGGCTGCTACAGGCACTCATGG - Intronic
996772165 5:127097295-127097317 GAAGCTGCCGCAGTCACTCATGG - Intergenic
997231110 5:132243737-132243759 GAGGCAGCCACAATCACCCCCGG - Intronic
997668157 5:135648900-135648922 TGGGCAGCCACAGGCCCCCAGGG - Intergenic
998456396 5:142277115-142277137 GATGCTGCCACTGGGACTCAGGG + Intergenic
999189062 5:149732806-149732828 GAGGGTGACAGAGCCACCCAGGG + Intronic
1000351617 5:160357017-160357039 GAGCCTGCAAAAGGCCCCCATGG + Intronic
1001295230 5:170494478-170494500 GAGGTTCCCACAGGCACTCTTGG + Intronic
1002276419 5:178107108-178107130 GGGGCTGCCCCAGTCACCCCTGG + Intergenic
1002987657 6:2206379-2206401 GAGCCTCCCAGAGGCACCCCTGG - Intronic
1005626737 6:27669526-27669548 GAGGCTGCCACTGGCTTTCACGG + Intergenic
1005808108 6:29494034-29494056 GAGGCTGACACAGACACAGAAGG + Intergenic
1006448392 6:34092351-34092373 TAGGCAGCCAGAGGCTCCCAGGG - Intronic
1007044794 6:38762004-38762026 GAGTCTAACACAGGCAGCCATGG - Intronic
1007498585 6:42279044-42279066 GAGGCTTCCAAAGGACCCCAAGG + Intronic
1011301493 6:85879026-85879048 GCTGGTGGCACAGGCACCCAAGG + Intergenic
1013122140 6:107150342-107150364 GAGGTGGTCACGGGCACCCAGGG + Intergenic
1015455730 6:133424553-133424575 GTCTCTGCCACTGGCACCCACGG - Intronic
1016983933 6:149880077-149880099 GTCCATGCCACAGGCACCCAGGG - Intergenic
1018537642 6:164838403-164838425 GGCTCTGCCACAGGCATCCATGG - Intergenic
1018635142 6:165854316-165854338 GCGCCTGGCACAGGGACCCAGGG + Intronic
1018931486 6:168242961-168242983 GAGGCCTGCACAGGAACCCAGGG - Intergenic
1019119578 6:169792472-169792494 GAGGCTCCCAAAGGGAGCCAGGG - Intergenic
1019427944 7:986190-986212 GGGGCTGCCACAGGCAGTCACGG + Intronic
1019504060 7:1381816-1381838 GAGACCCCCAGAGGCACCCAGGG + Intergenic
1019601798 7:1887753-1887775 CAGGCAGCCACATGCACACATGG - Intronic
1019891299 7:3949190-3949212 AAGGCTGCCTCAGCCCCCCAGGG + Intronic
1020454407 7:8355084-8355106 GAGACTTCCACAGGAAACCAAGG + Intergenic
1022324591 7:29319725-29319747 CAGACAGCCTCAGGCACCCATGG - Intronic
1023089301 7:36602988-36603010 GAGGTTGCTGCAGTCACCCAGGG - Intronic
1023868673 7:44251333-44251355 GAGTCTGACAGAGGCACCCGTGG - Intronic
1026804018 7:73418351-73418373 GAGGCTCCACCAGGCAGCCAGGG + Intergenic
1028184593 7:87768120-87768142 GAGGTTGACACAGGCACACTTGG - Intronic
1029381913 7:100220423-100220445 GAGGCTCCCACAGGCCTCCCAGG - Exonic
1029402077 7:100352873-100352895 GAGGCTCCCACAGGCCTCCCAGG - Exonic
1029493044 7:100882569-100882591 GAGGACGCCACAGCCACACAGGG - Intronic
1031099349 7:117460304-117460326 GAGGCTGTCACAGCAACCCTAGG - Intergenic
1034103989 7:148475057-148475079 GAGGCGGGCCCAGGAACCCATGG + Intergenic
1034488298 7:151380012-151380034 GTGGCAGCCACAGGCCCCAATGG + Intronic
1034914136 7:155023046-155023068 GAGGCTGGCACGGGGACCCCAGG + Intergenic
1035181151 7:157090532-157090554 GAGGCTGCCCCAGGTGCCCCTGG - Intergenic
1035567894 8:653851-653873 GTGGCTGCCACATGCGCGCAGGG + Intronic
1036649668 8:10634339-10634361 GAGGCTGCAACACGGACCCTAGG + Intronic
1037892056 8:22628706-22628728 GAGGCTGCCACAGGCACCCATGG - Intronic
1038000428 8:23386864-23386886 GCGGCTTTCACAGGCACGCAAGG + Intronic
1038048156 8:23784608-23784630 GAGGCTGCCAGATCCATCCATGG - Intergenic
1039469254 8:37803365-37803387 GAGGCTGCCCCAGCCTCCCTGGG + Intronic
1039886080 8:41654462-41654484 GAGCCTGGCACCTGCACCCAGGG + Intronic
1040309979 8:46231816-46231838 GAGCCTACCACAGGGACTCAGGG + Intergenic
1040340070 8:46436003-46436025 GGGCCTGCCACAGGGACTCATGG - Intergenic
1040519251 8:48160705-48160727 GAGGCTCCCAAGGGCACCAAGGG + Intergenic
1044618561 8:94166809-94166831 TAGGCTGCCACAAGTAGCCAGGG + Intronic
1047255287 8:123209258-123209280 GAGGATGCCACAGGCCGTCAGGG - Exonic
1048277259 8:133076302-133076324 GAGGCTGACACAGCCACCCTGGG + Intronic
1049093448 8:140534161-140534183 GTGGCTGTCACAGGGGCCCAGGG + Intronic
1049102473 8:140589428-140589450 GAGGCTGGCACAGGGGCCCAGGG + Intronic
1049452673 8:142670352-142670374 GGGGCAGCCACAGGCGCCCAGGG + Intronic
1050364337 9:4860318-4860340 GAAGCTGCCACGGACACCAATGG + Exonic
1053179878 9:35959960-35959982 GACGCTGCCACATGCTTCCAGGG + Intergenic
1056112407 9:83408784-83408806 GCTGCTACCACAGGCACCCTCGG + Intronic
1059245226 9:112844069-112844091 AAGGCTGTCACAGGGAGCCAAGG + Intronic
1060300433 9:122371625-122371647 GAGGAAGCCGCAGGCACCAAGGG + Intronic
1060972763 9:127748249-127748271 CAGGATGCCTCAGGCACACATGG + Intronic
1061960735 9:133987718-133987740 GATGCTGGCACAGGCAACCTCGG + Intronic
1062218819 9:135403516-135403538 GAGGCTGCCAGGAGCACCCCTGG + Intergenic
1062291341 9:135796573-135796595 CAGGCTGCAAAGGGCACCCACGG + Intergenic
1062399407 9:136365865-136365887 GCTCCTGCCACAGCCACCCAGGG + Intronic
1203568107 Un_KI270744v1:108705-108727 CAGTCAGCCCCAGGCACCCAGGG - Intergenic
1185641733 X:1592310-1592332 CAGGCTGCCGCTGGCACCCCTGG - Intronic
1185791472 X:2930747-2930769 GAGGCTGTCACCGCCTCCCAAGG + Intergenic
1188899353 X:35710959-35710981 GAGGCTCCCAGAGAGACCCAGGG + Intergenic
1189272256 X:39759834-39759856 GAGGCAGCCCCAGGCAGCCCCGG + Intergenic
1189318836 X:40075017-40075039 GAGGCTGCCACAAGCACTCTAGG - Exonic
1189354150 X:40298779-40298801 GAGGCTGTTAGAGGCAGCCAGGG - Intergenic
1190204889 X:48394764-48394786 GGGGCTGCCACAGCCACCAGAGG + Intergenic
1190205647 X:48400639-48400661 GGGGCTGCCACAGCCACCAGAGG - Intergenic
1190885175 X:54525264-54525286 GAGGCTGAGGCAGGAACCCAGGG + Intergenic
1191110328 X:56799195-56799217 GGGGCTGCCAGGGGAACCCATGG - Intergenic
1192795920 X:74423668-74423690 ATGGCTGCCACAGTCACCCCTGG + Intronic
1195984492 X:110614580-110614602 CTGGCTTCCACAGGCACCCATGG - Intergenic
1198340454 X:135708529-135708551 ACGGCTGACACAGGCACCCACGG - Intergenic
1198341080 X:135713852-135713874 GCGGCTGACACAGGCGCCCATGG - Intronic
1198341121 X:135714008-135714030 GAGGCCGACACAAGCAACCAAGG - Intronic
1198343928 X:135741255-135741277 ACGGCTAACACAGGCACCCACGG - Intergenic
1198346797 X:135767597-135767619 GAGACCGACACAGGCAACCAAGG + Intronic
1198346848 X:135767770-135767792 GCGGCTGACACAGGCGCCCATGG + Intronic
1198348704 X:135784881-135784903 GAGGCCGACACAGGCAACCAAGG + Intergenic
1198348755 X:135785054-135785076 GCGGCTGACACAGGCGCCCATGG + Intergenic
1198350609 X:135802155-135802177 GAGGCCGACACAGGCAACCAAGG + Intronic
1198350660 X:135802328-135802350 GCGGCTGACACAGGCGCCCATGG + Intronic
1198352516 X:135819418-135819440 GAGGCCGACACAGGCAACCAAGG + Intronic
1198352567 X:135819591-135819613 GCGGCTGACACAGGCGCCCATGG + Intronic
1198354425 X:135836686-135836708 GAGGCCGACACAGGCAACCAAGG + Intronic
1198354476 X:135836859-135836881 GCGGCTGACACAGGCGCCCATGG + Intronic
1198356335 X:135853944-135853966 GAGGCCGACACAGGCAACCAAGG + Intronic
1198356386 X:135854117-135854139 GCGGCTGACACAGGCGCCCATGG + Intronic
1198358248 X:135871218-135871240 GAGACCGACACAGGCAACCAAGG + Intergenic
1198358299 X:135871391-135871413 GCGGCTGACACAGGCGCCCATGG + Intergenic
1198360162 X:135888492-135888514 GAGGCCGACACAGGCAACCAAGG + Intronic
1198360213 X:135888665-135888687 GCGGCTGACACAGGCGCCCATGG + Intronic
1198360758 X:135893008-135893030 GAGGCTGACACAGGCAACCAAGG + Intronic