ID: 1037892060

View in Genome Browser
Species Human (GRCh38)
Location 8:22628725-22628747
Sequence GGTCCCAGAGACGGACACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037892060_1037892070 11 Left 1037892060 8:22628725-22628747 CCTCTGTGTCCGTCTCTGGGACC 0: 1
1: 0
2: 1
3: 23
4: 196
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data
1037892060_1037892071 15 Left 1037892060 8:22628725-22628747 CCTCTGTGTCCGTCTCTGGGACC 0: 1
1: 0
2: 1
3: 23
4: 196
Right 1037892071 8:22628763-22628785 CAGAAAAGCCCTCTGTGGGCAGG No data
1037892060_1037892069 10 Left 1037892060 8:22628725-22628747 CCTCTGTGTCCGTCTCTGGGACC 0: 1
1: 0
2: 1
3: 23
4: 196
Right 1037892069 8:22628758-22628780 TGGCACAGAAAAGCCCTCTGTGG No data
1037892060_1037892063 -10 Left 1037892060 8:22628725-22628747 CCTCTGTGTCCGTCTCTGGGACC 0: 1
1: 0
2: 1
3: 23
4: 196
Right 1037892063 8:22628738-22628760 CTCTGGGACCCCTGTGGCCCTGG No data
1037892060_1037892072 16 Left 1037892060 8:22628725-22628747 CCTCTGTGTCCGTCTCTGGGACC 0: 1
1: 0
2: 1
3: 23
4: 196
Right 1037892072 8:22628764-22628786 AGAAAAGCCCTCTGTGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037892060 Original CRISPR GGTCCCAGAGACGGACACAG AGG (reversed) Intronic
900312787 1:2042477-2042499 GGTCCCAGGGCCGGGCACGGTGG + Intergenic
900475339 1:2873788-2873810 GGTCTCAGACAAGGACGCAGAGG + Intergenic
900531160 1:3154145-3154167 GGTCCCGGTGACAGCCACAGCGG - Intronic
900621397 1:3589105-3589127 GGCCCCAGAGACACACAGAGGGG + Intronic
900652392 1:3736280-3736302 GGTGCCAGGGCCGGCCACAGAGG - Intergenic
900832153 1:4973107-4973129 TGTCCTGGAGAAGGACACAGAGG - Intergenic
904081942 1:27877735-27877757 GGTCCCAGAGAGGCCCAGAGAGG - Intronic
904292660 1:29497858-29497880 GGTCCAAGAAACAGGCACAGGGG + Intergenic
905134251 1:35786267-35786289 GGGCCCAGGGCCGGGCACAGTGG + Intergenic
915323806 1:155070374-155070396 AGGTCCAGAGACCGACACAGAGG + Intergenic
915555738 1:156659830-156659852 GGTCCCAGAGAGGAAGGCAGAGG + Intergenic
915951881 1:160195142-160195164 GGATCCAGAGAGGGGCACAGTGG - Intronic
920555075 1:206898770-206898792 GGTCCCAGGGAGGGGCACAGAGG - Intronic
921702361 1:218283211-218283233 GGTTCCAGATCAGGACACAGTGG + Intergenic
1066194382 10:33084445-33084467 AGTCCCAGAATCTGACACAGCGG - Intergenic
1067526515 10:47042569-47042591 GTTCCCAGAGCCGAAAACAGTGG - Intergenic
1068803500 10:61168801-61168823 GGGCCCAAAGAATGACACAGTGG - Intergenic
1068968199 10:62934528-62934550 GGTCCCAGAGAAGCATTCAGAGG - Intergenic
1070772113 10:79088549-79088571 GGTGACAGAGAGGGACACATGGG + Intronic
1073543403 10:104330014-104330036 GGCCCCAGGGGCTGACACAGAGG + Intronic
1075256940 10:120932834-120932856 GGACACAGAGACTCACACAGAGG + Intergenic
1075553616 10:123412765-123412787 AGACACAGAGACAGACACAGAGG - Intergenic
1075828015 10:125377186-125377208 GGTGCCAGTGATGGAGACAGAGG - Intergenic
1076597896 10:131637290-131637312 GGTCACAGAGAAGGAAACGGTGG + Intergenic
1076787999 10:132760648-132760670 CGTACCAGAGATGGGCACAGAGG - Intronic
1077154970 11:1087171-1087193 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077155029 11:1087337-1087359 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077155054 11:1087426-1087448 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077155058 11:1087438-1087460 GCACCCAGAGAAGGACCCAGAGG - Intergenic
1077266644 11:1654152-1654174 GGAGACAGAGACGGAAACAGAGG - Intergenic
1077893484 11:6436786-6436808 GGGCCCAGAGAGGTCCACAGGGG + Intronic
1079129600 11:17739944-17739966 AGTCCCAGAGACTGAGGCAGTGG - Intronic
1083699961 11:64469723-64469745 GGACCCAGAGACAGATACAAAGG + Intergenic
1083895480 11:65617795-65617817 GGTCCCACAGAGGAATACAGAGG - Intronic
1084913678 11:72411644-72411666 AGTCCCAGAAAGGGACACAGGGG + Intronic
1087499940 11:98937807-98937829 GGTCCCAGACAGGTACAGAGGGG - Intergenic
1090434834 11:126677930-126677952 GGTCCCAGGGCCTGACACTGAGG - Intronic
1090493264 11:127184929-127184951 GGTCCCAGATACGCAAATAGTGG + Intergenic
1091527970 12:1324521-1324543 AGTCTCAGAGACGGTCACTGGGG + Intronic
1092209662 12:6638124-6638146 AGTCCCAGAGAGGGCCACGGTGG - Exonic
1093626652 12:21357285-21357307 GGTCACAGAGACACACACACAGG + Intronic
1098273836 12:68794148-68794170 GGATCCAGAGACACACACAGTGG - Intergenic
1100187566 12:92154134-92154156 GGTGACAGAGACAGAGACAGAGG + Intergenic
1101781722 12:107844056-107844078 GCTCCCAGAGACGCGGACAGAGG - Intergenic
1102245902 12:111355621-111355643 GGCCCCAGGGAGGGACAGAGGGG + Intergenic
1102526329 12:113514929-113514951 GGTCCCTGAGCCGGGCACAGTGG - Intergenic
1103029535 12:117601478-117601500 GGACACAGAGACCCACACAGAGG + Intronic
1104237987 12:126958248-126958270 GGTCCCAGAGGTGGACAAACTGG + Intergenic
1109960133 13:69618720-69618742 AGACACAGAGAGGGACACAGGGG + Intergenic
1112554260 13:100452256-100452278 GGACACAGAGACAGAGACAGGGG - Intronic
1113020626 13:105882236-105882258 TGTCCCAGAAACGGACACAACGG + Intergenic
1113093775 13:106641467-106641489 GGACCCAGAGACATACTCAGAGG + Intergenic
1113335788 13:109374485-109374507 GGTCCCAGAGAGGGACTCTGCGG + Intergenic
1114549582 14:23525261-23525283 GGTCCCAGAGCCTGAGGCAGGGG - Exonic
1116808012 14:49512089-49512111 GGGCATAGAGACAGACACAGAGG + Intergenic
1117029512 14:51653213-51653235 GGTCCCAGAGAAGAACAGAAGGG - Intronic
1118364774 14:65085628-65085650 GGTCCCACAAAAGGCCACAGAGG + Intronic
1120265228 14:82240223-82240245 GGTACTACAGCCGGACACAGTGG + Intergenic
1120438782 14:84510298-84510320 AGACCCAGAGACAGTCACAGAGG - Intergenic
1122200193 14:100117827-100117849 GCTCCCAGAGCAGGAAACAGTGG - Intronic
1122292604 14:100687711-100687733 GGTCCCAGAGCTAGCCACAGAGG - Intergenic
1127743539 15:61938794-61938816 GGTCTCAGAGAAGTACACACGGG - Intronic
1128472965 15:67971586-67971608 GGACCCTGAGACAGACACACAGG + Intergenic
1128769798 15:70273386-70273408 AGTCCCAGAGTGTGACACAGAGG + Intergenic
1129237027 15:74229866-74229888 TGTCCCAGAGAAGCCCACAGTGG + Intergenic
1130060236 15:80564346-80564368 GGGCTCAGAGACGGCAACAGAGG - Intronic
1131083838 15:89559047-89559069 GGACCCAGGGAAAGACACAGCGG + Intergenic
1132827949 16:1914263-1914285 CGTCCCAGGGACAAACACAGAGG + Intronic
1136870911 16:33807482-33807504 GTTCTCAGGGAAGGACACAGGGG - Intergenic
1137366730 16:47865952-47865974 TGTGCTAGAGACAGACACAGGGG + Intergenic
1137672293 16:50286014-50286036 AGTCTCAGAGAGGGACACAGTGG - Intronic
1138916479 16:61471163-61471185 GGTCCCAGAGACAGACTGAGTGG + Intergenic
1139287051 16:65825118-65825140 GGTCCCAGAGATACACACAGTGG + Intergenic
1139481673 16:67234181-67234203 GGGCCCGGAGCAGGACACAGGGG + Exonic
1139960142 16:70712832-70712854 AGTCCAAGAGAAGCACACAGAGG - Intronic
1141013818 16:80428594-80428616 GGTCACAGAGAATGACATAGGGG + Intergenic
1141153154 16:81578725-81578747 GTCCCCAGAGAGGGACACAGAGG - Intronic
1141778696 16:86142306-86142328 GGACACAGAGACACACACAGAGG + Intergenic
1203101261 16_KI270728v1_random:1308576-1308598 GTTCTCAGGGAAGGACACAGGGG + Intergenic
1143447244 17:7016796-7016818 GTTCCCAGAGAGGGGCAGAGGGG + Intronic
1144664234 17:17091206-17091228 GGTCCCAGCAGCGGACCCAGAGG + Intronic
1144780769 17:17807338-17807360 AGTCCCAGTGCCTGACACAGAGG - Intronic
1147403648 17:40195453-40195475 GGTCCCAGTGTCCGACCCAGAGG - Exonic
1147571920 17:41576674-41576696 GGACCCAGAGAGGCAGACAGAGG + Intergenic
1148584826 17:48769974-48769996 TGGCCCAGAGACGGACAGGGTGG - Exonic
1150480244 17:65503715-65503737 GGGCCCAGAGACAGAGACTGGGG + Intergenic
1151682403 17:75629004-75629026 GGCCCCAGAGAAGTACACAGGGG - Exonic
1151983569 17:77528355-77528377 GGTCCCAGAGAGGAACAGAGGGG - Intergenic
1152020728 17:77779044-77779066 GGCCACAAAGACAGACACAGAGG - Intergenic
1153032778 18:730542-730564 GGTCCCAGAGAAGGAACCATAGG - Intronic
1155176041 18:23302191-23302213 GGAGCCAGACACAGACACAGAGG + Intronic
1155365722 18:25047470-25047492 GGTCCTTGAGGAGGACACAGGGG - Intergenic
1157002456 18:43542797-43542819 AGACACAGAGACAGACACAGAGG + Intergenic
1158352847 18:56581085-56581107 GGTTCCAGAGACGTATACATAGG + Intergenic
1159840550 18:73394025-73394047 GCTAGCAGAGCCGGACACAGTGG + Intergenic
1160491013 18:79336564-79336586 GGCCCCACACACGGCCACAGGGG + Intronic
1160557385 18:79735195-79735217 GGTACGAGAAACGGCCACAGAGG - Intronic
1160681300 19:412773-412795 GTTTCCAGAGAGGGACACTGAGG + Intergenic
1160707148 19:535002-535024 GGCCCCAGTGCCAGACACAGAGG - Intronic
1160839340 19:1138626-1138648 GGACACACAGACAGACACAGTGG + Intronic
1161115241 19:2493087-2493109 TGTCCTGGAGACAGACACAGAGG + Intergenic
1161257244 19:3316200-3316222 TGTCCCAGAGCGGGAGACAGAGG + Intergenic
1161560764 19:4971358-4971380 GGTGGGAGAGAAGGACACAGAGG - Intronic
1162982331 19:14248064-14248086 GGTTCCAGAGAGGGAAACTGGGG - Intergenic
1163398994 19:17080468-17080490 GGACACAGAGACAGGCACAGAGG - Intronic
1165682625 19:37790601-37790623 GGTCCAGGAGACGGAGCCAGAGG - Intronic
1165854563 19:38871646-38871668 GGGCCCAGAGATGAACACACAGG - Exonic
1165939051 19:39406311-39406333 AGTCCCAGAGACAGATTCAGAGG - Intergenic
1166142984 19:40815355-40815377 GGACCCAGCCAGGGACACAGAGG - Intronic
1166184576 19:41131476-41131498 GGGCCCAGCCAGGGACACAGAGG + Intergenic
1166569384 19:43784233-43784255 GGAGACAGAGACTGACACAGAGG + Intergenic
928613281 2:33011500-33011522 GGACACAGAGACAGACACAGAGG + Intronic
929484388 2:42341130-42341152 AGTCCCACAGGGGGACACAGTGG + Intronic
930240395 2:48930165-48930187 TTTCCCAGAGAAGGACACAGAGG + Intergenic
938872910 2:135499977-135499999 GGACCCAGAGACATAAACAGAGG + Intronic
938893757 2:135730907-135730929 GGTTCCAGGGCCGGACGCAGTGG - Intergenic
942188303 2:173445655-173445677 GGGCACAGAGACAGACACACTGG - Intergenic
945943750 2:215974480-215974502 AGTCCCAGATACAGACGCAGTGG - Intronic
946200832 2:218069846-218069868 GGGCCCAGAGAGGGACACTGTGG - Intronic
946201186 2:218071759-218071781 GGGCCCGGAGAGGGACACTGTGG - Intronic
946319545 2:218943862-218943884 GGACACAGAAACAGACACAGTGG + Intergenic
948152614 2:235756230-235756252 GGTGCCACAGAGGAACACAGGGG + Intronic
948370149 2:237483707-237483729 GGTACCAGCGACGGGCACACTGG + Intergenic
948390184 2:237606360-237606382 GGACACAGAAACGCACACAGAGG + Intergenic
948650393 2:239440061-239440083 AGTCCCAGAGCAGGACTCAGGGG + Intergenic
948795824 2:240401680-240401702 GGACAGAGAGACAGACACAGAGG - Intergenic
1170404129 20:16018744-16018766 GGTCCAAGAGAAGGAATCAGTGG - Intronic
1171361032 20:24586458-24586480 GGTCCCAGACTGGGACACACAGG + Intronic
1172210097 20:33191280-33191302 GGTCCCAGGGAGGCTCACAGAGG - Intergenic
1175080624 20:56417529-56417551 GTTCCCAGAGAGGAAGACAGAGG - Intronic
1176167501 20:63681750-63681772 GGCCACAGAGACGGCCACAGTGG - Intronic
1176287001 21:5023578-5023600 GGTCCAAGGAAAGGACACAGAGG + Intronic
1179525199 21:41971454-41971476 CATCCGAGAGACGGACACACGGG + Intergenic
1179728329 21:43353442-43353464 GGTCCCAGAGGCGCAGAGAGAGG + Intergenic
1179870180 21:44239897-44239919 GGTCCAAGGAAAGGACACAGAGG - Intronic
1180725868 22:17946138-17946160 GTTCCCTGAGACAGCCACAGGGG - Intronic
1183474514 22:38028684-38028706 CATCCCACAGAGGGACACAGTGG - Intronic
951114035 3:18838796-18838818 GGACACAGAGACAGAGACAGTGG - Intergenic
954362904 3:50131798-50131820 GGTCCCAGAGAGGAACAGAAAGG - Intergenic
961416423 3:126761335-126761357 GGACACAGAGACAGACACAGAGG - Intronic
962987805 3:140551590-140551612 GGTGCCAGAGACGTAGGCAGGGG + Intronic
965132115 3:164714451-164714473 GGACACAGAGACTGACACACAGG - Intergenic
965691092 3:171357848-171357870 GCTACCATAGATGGACACAGTGG + Intronic
966540864 3:181088301-181088323 GCTCCCAGAGTCGCGCACAGAGG - Intergenic
967223820 3:187272579-187272601 GGACACAGAGACACACACAGAGG + Intronic
967270107 3:187725995-187726017 GGTTCCAGAGAGGGAAACTGAGG - Intronic
968248986 3:197187819-197187841 TGTCGAAGAGAAGGACACAGTGG - Intronic
970291761 4:14580715-14580737 GGTTCCAGATATGGCCACAGAGG - Intergenic
970313820 4:14810149-14810171 GATCAGAGAGACAGACACAGAGG - Intergenic
972937045 4:44149503-44149525 GGGCCAAGAGAGAGACACAGGGG - Intergenic
976213452 4:82693750-82693772 GGTCCCCCAGACGGACACAGAGG + Intronic
977176169 4:93822409-93822431 CCTCCCAGAGAAGGACACATGGG + Intergenic
977603989 4:98963818-98963840 GGTCCCAGACACCCACTCAGGGG - Intergenic
980071127 4:128243646-128243668 GGCTCCAGAAACGGACTCAGAGG - Intergenic
980905945 4:138949028-138949050 GGCCCCAGAGAAGGACAGAATGG + Intergenic
981956829 4:150485561-150485583 GGACACAGAGACATACACAGGGG + Intronic
985206771 4:187546720-187546742 TCTCCCAGAGACAGACACACAGG - Intergenic
985387704 4:189464425-189464447 GGTACCACAGAGTGACACAGTGG + Intergenic
985785640 5:1892524-1892546 GGACACAGAGACACACACAGGGG - Intergenic
986738313 5:10683538-10683560 GACCCCAGAGATGAACACAGTGG + Exonic
988677388 5:33446636-33446658 AATCACAGAGACTGACACAGAGG + Intronic
993022364 5:82606271-82606293 GGGCCCAGGGAGGCACACAGTGG - Intergenic
997611010 5:135215741-135215763 GGCCCCTGAGACGGAGACACTGG - Intronic
998146840 5:139733952-139733974 GGACCCACAGAGGGACACAAAGG - Intergenic
999251972 5:150188214-150188236 AGTCCCAGTGACTGCCACAGTGG + Intergenic
1000514050 5:162218592-162218614 GCTACCAGAGACCAACACAGTGG - Intergenic
1002670457 5:180861769-180861791 GGTCCCAGGGACGGCTCCAGGGG - Intergenic
1003650805 6:7958520-7958542 GGTTCCATAGAAGGAGACAGTGG - Intronic
1005141523 6:22637308-22637330 GGTCTCTGAGACTGACAGAGAGG - Intergenic
1006018486 6:31102548-31102570 AGTCCCAGTGACGGCCACAGGGG - Intergenic
1006315207 6:33287405-33287427 GGTCACAGCGGCGGATACAGTGG + Exonic
1007211241 6:40194898-40194920 GGCCCCACAGACACACACAGGGG - Intergenic
1008762218 6:54865332-54865354 GGACACAGAGACAGACACAAAGG - Intronic
1010772569 6:79848227-79848249 GGTCCCAGTGGTGGCCACAGAGG + Intergenic
1013377014 6:109527097-109527119 AGACCCAGAGACGGAGCCAGGGG + Intronic
1017175879 6:151504553-151504575 GGTCTCAGAGAAGGACCTAGAGG + Intronic
1019441708 7:1050790-1050812 GGACCCAGAGACGGGCACACCGG + Intronic
1020314786 7:6897827-6897849 GGGCCCAGAGAAGGATACAGTGG + Intergenic
1023315033 7:38927660-38927682 GGTAACAGAGATGGACACAGAGG + Intronic
1024988685 7:55218223-55218245 GGGCCCAGTGGCTGACACAGTGG + Intronic
1029463045 7:100707163-100707185 GGAGCCAGAGACCGACACACGGG + Exonic
1029614871 7:101649975-101649997 GGGCAGAGAGACGGACAGAGAGG - Intergenic
1029687610 7:102159571-102159593 GGTCCCCCAGCCGGGCACAGTGG + Intronic
1031333584 7:120497742-120497764 GGTCCCAGAAGCTGACACACAGG + Intronic
1032394789 7:131581610-131581632 GGGCCCGGGGACGGACACAGGGG - Intergenic
1034457605 7:151179716-151179738 GGTCCCAGAGACAGGCTGAGAGG + Intronic
1034865145 7:154635299-154635321 AGTCCCAGAGATGGTGACAGTGG - Intronic
1035216703 7:157372914-157372936 GGACACAGAGACAGACACAAAGG - Intronic
1035265562 7:157688895-157688917 GGCCCCAGCGCCGGACACAAAGG + Intronic
1037892060 8:22628725-22628747 GGTCCCAGAGACGGACACAGAGG - Intronic
1039444651 8:37621442-37621464 GGTCTCTGAGAAGGACAGAGTGG - Intergenic
1042206770 8:66337494-66337516 GGACACAGAGACAGACATAGAGG - Intergenic
1043078661 8:75736077-75736099 GGTCCCAGTAACGGATCCAGTGG + Intergenic
1045686459 8:104717814-104717836 GGTCAGAGAGAAGGACCCAGAGG - Intronic
1046898926 8:119502738-119502760 TGTCCCAGAGAGTGACAGAGGGG - Intergenic
1047095259 8:121618304-121618326 AGTCCCAGAGAGGGTCTCAGTGG + Intronic
1047770466 8:128026550-128026572 GGTTGCAGAGATGGAGACAGAGG - Intergenic
1049196096 8:141316442-141316464 GGACCCAGGGACGGACAGGGTGG - Intergenic
1049210213 8:141382880-141382902 GTTCACAGAGAGGGAAACAGAGG - Intergenic
1049300746 8:141868107-141868129 GATCCCAGAGTCGGGCACAGGGG - Intergenic
1049804343 8:144532222-144532244 GACCCCAGAGGCGGAGACAGGGG + Intronic
1056836708 9:89961451-89961473 GATCCCTGAGAGGCACACAGTGG - Intergenic
1056923235 9:90810322-90810344 GGACCCAGAGACAGGCACACAGG - Intronic
1060401616 9:123353063-123353085 GGCCCCAGACTCAGACACAGAGG + Intergenic
1060945976 9:127569353-127569375 GGTCCCAGAAAGGGAGACCGCGG + Intronic
1061835329 9:133324971-133324993 GGACCCACAGACAGGCACAGGGG + Intergenic
1061964339 9:134004619-134004641 GTTCCCGGTGACAGACACAGAGG - Intergenic
1062097064 9:134708972-134708994 GGTCACACAGAGAGACACAGGGG - Intronic
1185813619 X:3133040-3133062 ATTCTCAGAGACAGACACAGAGG - Intergenic
1186200367 X:7149822-7149844 GGACACAGAGACACACACAGAGG - Intergenic
1186312813 X:8338966-8338988 TTTCCCAGAGGCGGACACTGGGG - Intergenic
1186890774 X:13957194-13957216 GGTCCAAGCCAAGGACACAGTGG - Intergenic
1190382847 X:49856193-49856215 GGTCCCAGAGTGGGAGTCAGGGG - Intergenic
1190879502 X:54482754-54482776 AGACCCAGAGATGGACATAGAGG + Intronic
1191056376 X:56245562-56245584 GGTCCTATAGAAGGAAACAGAGG - Intronic
1197344568 X:125317363-125317385 GCCCACAGATACGGACACAGAGG - Intergenic
1198569364 X:137938753-137938775 GATCCCAGAGAGGGACTCAGCGG - Intergenic
1199720377 X:150539188-150539210 GGACACAGAGACGGAGACACAGG + Intergenic
1200702590 Y:6414865-6414887 GATCACAGAGACGGACGAAGGGG - Intergenic
1201031520 Y:9749832-9749854 GATCACAGAGACGGACGAAGGGG + Intergenic
1202112816 Y:21442299-21442321 GTTCCCAGTGACGGCCAAAGAGG - Intergenic