ID: 1037892062

View in Genome Browser
Species Human (GRCh38)
Location 8:22628734-22628756
Sequence GGCCACAGGGGTCCCAGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 1, 2: 1, 3: 49, 4: 350}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037892062_1037892072 7 Left 1037892062 8:22628734-22628756 CCGTCTCTGGGACCCCTGTGGCC 0: 1
1: 1
2: 1
3: 49
4: 350
Right 1037892072 8:22628764-22628786 AGAAAAGCCCTCTGTGGGCAGGG No data
1037892062_1037892070 2 Left 1037892062 8:22628734-22628756 CCGTCTCTGGGACCCCTGTGGCC 0: 1
1: 1
2: 1
3: 49
4: 350
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data
1037892062_1037892069 1 Left 1037892062 8:22628734-22628756 CCGTCTCTGGGACCCCTGTGGCC 0: 1
1: 1
2: 1
3: 49
4: 350
Right 1037892069 8:22628758-22628780 TGGCACAGAAAAGCCCTCTGTGG No data
1037892062_1037892071 6 Left 1037892062 8:22628734-22628756 CCGTCTCTGGGACCCCTGTGGCC 0: 1
1: 1
2: 1
3: 49
4: 350
Right 1037892071 8:22628763-22628785 CAGAAAAGCCCTCTGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037892062 Original CRISPR GGCCACAGGGGTCCCAGAGA CGG (reversed) Intronic
900119494 1:1042402-1042424 GGCCAGAGGACTCCCAGGGAGGG - Intronic
900322568 1:2092364-2092386 CGCCTCAGGGTGCCCAGAGAGGG + Intronic
900396568 1:2455472-2455494 GGGCACAGGGTCCCCAGAGAAGG + Intronic
900400774 1:2472048-2472070 GGCCTGAGGGGTCCCAGCAAGGG - Intronic
900481814 1:2902996-2903018 GGCCACCGGAGGCCCAGGGAGGG - Intergenic
901057165 1:6453993-6454015 GGCCACAGGGGAGCTGGAGAAGG + Intronic
901084857 1:6604048-6604070 GCCCACGTGGGTCCCAGAGCAGG + Intronic
901333873 1:8431825-8431847 GGCCACAGGGAGCTAAGAGAGGG - Intronic
901433797 1:9234447-9234469 GGCCTGAGGAGTCCCAGAGCGGG + Intergenic
901525765 1:9822908-9822930 GGCACCAGGGGTAGCAGAGACGG + Intronic
901884658 1:12214618-12214640 GGCAGAAGGGGTCCCTGAGATGG - Intergenic
901884706 1:12214915-12214937 GGACACAGGGGACCAAGGGATGG + Intergenic
902477201 1:16694500-16694522 GGCCACAGGGGAGCTGGAGAAGG - Intergenic
902619404 1:17642227-17642249 CGCCTCAGGGGTCCCCCAGATGG - Intronic
902624454 1:17668475-17668497 GGCCATTGGGGCCCCAGGGATGG - Intronic
903060236 1:20664102-20664124 TGGCACAGGGGTCCCACAGCAGG - Exonic
903213702 1:21831868-21831890 GGGTAGAGGGGTCCCAGAGGAGG + Intronic
903830348 1:26170680-26170702 GTCCACTGAGGTCCCTGAGATGG + Exonic
904000611 1:27336425-27336447 GGGCAAGGGGGCCCCAGAGAGGG - Intergenic
904246943 1:29194533-29194555 GGCCAGAGGAGGCCCAGAGAGGG + Intronic
904307936 1:29602277-29602299 GGGGACTTGGGTCCCAGAGAAGG - Intergenic
904317590 1:29675775-29675797 GGCCCCAGTGGTGCCTGAGAAGG + Intergenic
904380617 1:30108260-30108282 GGCCACAGGGAGCCCAGAAGAGG + Intergenic
905205245 1:36339617-36339639 GGCCACAGTGGTTCCAGATCAGG + Exonic
905334705 1:37236506-37236528 GGAGGCAGAGGTCCCAGAGATGG - Intergenic
905892336 1:41525261-41525283 GGCCACCAGAGTCCCAGAGAGGG + Intronic
906799259 1:48721658-48721680 GACCACAGGGGTCCCTGATCTGG - Intronic
907283714 1:53367354-53367376 GGCCACATGGGCTCCAGGGATGG - Intergenic
907359944 1:53906305-53906327 GGGGACAGGGGGCCCAGGGAGGG + Intronic
907442653 1:54488588-54488610 GGGCACAGGGGTCCCAGGCTGGG - Intergenic
907729533 1:57052612-57052634 GGCCACTGGGGTACCTGACATGG + Intronic
910368718 1:86493506-86493528 GTCCACTGGGATCCCAGAGAAGG - Exonic
912798435 1:112706703-112706725 GGCCGCAGGGGACCTAGAGTGGG - Intronic
917204890 1:172561780-172561802 GGCCACAGGGTTCCCACCAAGGG + Intronic
919926279 1:202193494-202193516 GGTCACATGGGACCCAGAGGAGG - Intergenic
920202201 1:204266458-204266480 GGCCACAGTGGAGCCAGAGTGGG - Intronic
920203143 1:204273022-204273044 GGTCACAGGGGACCCTGACAAGG - Intronic
921621891 1:217334457-217334479 GGCCACTGTGTTCCCAGGGATGG + Intergenic
921892725 1:220369214-220369236 GTCCACAGGTGTCAGAGAGAGGG - Intergenic
922766940 1:228160901-228160923 GGCCACAGGGTGCCCAGATATGG - Intergenic
923314051 1:232762264-232762286 GGTCTCAGGGGTGACAGAGATGG - Intergenic
1062813675 10:483757-483779 GGCCACTGGGGTCTCAGAAGAGG - Intronic
1063168805 10:3487432-3487454 CGCCACAGGGGACTCAGATATGG + Intergenic
1063256843 10:4337812-4337834 GGCCTCAGGGATCTCAGAAAGGG - Intergenic
1067752009 10:48977869-48977891 GGCCTCAGGGCTCCCACAGTAGG + Intronic
1068946983 10:62739381-62739403 AGCCACAGAGGTCTCAGGGAGGG - Intergenic
1069856443 10:71443575-71443597 GGCCATGGGGGTGGCAGAGAGGG + Intronic
1070680149 10:78443348-78443370 GGGCACAGCGGTCACAGACACGG - Intergenic
1070747740 10:78944948-78944970 TTCAACAGGGGGCCCAGAGATGG - Intergenic
1071444036 10:85729590-85729612 GGCGACATGGGACTCAGAGAAGG - Exonic
1071470725 10:85982470-85982492 GGCCACAGGCGTCCTCGGGATGG - Intronic
1072555033 10:96508309-96508331 GGCAACAGCTGCCCCAGAGAGGG + Intronic
1073054725 10:100692063-100692085 GGCCCTAGCAGTCCCAGAGATGG - Intergenic
1073070629 10:100791074-100791096 GGCCACAGGGCTCCAAGAATGGG - Intronic
1073424238 10:103446656-103446678 GCCCACAGGGGTGGCAGGGAGGG - Intergenic
1073571389 10:104583629-104583651 GGCCCCTGGGATTCCAGAGATGG + Intergenic
1073668194 10:105556986-105557008 GGCCACAGGGTTCCCTGATTTGG + Intergenic
1075780784 10:125015944-125015966 GGCCACAGGCAACCCAGAGATGG + Intronic
1076402731 10:130194327-130194349 GGCCACAGGAGACCCACACACGG - Intergenic
1076575116 10:131460718-131460740 GGCAACAGAGGTCCCAGAGCTGG - Intergenic
1077017813 11:404679-404701 GCACACAGGGGCCCCAGCGAGGG - Exonic
1077045701 11:544330-544352 GGCCACTGGGCTCCAAGAGTTGG - Intronic
1077390516 11:2298842-2298864 GGGCAGAGGGGACCCAGGGATGG - Intronic
1077545458 11:3167397-3167419 GGCGTCAGAGGTCTCAGAGATGG + Intergenic
1077558234 11:3237861-3237883 GGCCATAGGGGTCCCACTGAGGG - Intergenic
1078291911 11:10020117-10020139 GGTCACAGTGGTGCCAGGGAAGG + Intronic
1080795454 11:35558937-35558959 GACCAAAGGGGTCCCAAAGGTGG - Intergenic
1081621630 11:44622311-44622333 GCCCACAGAGGGCCCAGGGAGGG - Intergenic
1083656599 11:64232754-64232776 GGCCACAGGGGCCCCAGTTGAGG + Exonic
1083716149 11:64578133-64578155 GGCTACAAGTGGCCCAGAGAGGG - Intergenic
1084286352 11:68133732-68133754 GGCCACAGCGGTCCCACTTAGGG + Intergenic
1084401031 11:68942970-68942992 GCCCAGAGGGATCCCAGAGTGGG + Intergenic
1084401293 11:68944976-68944998 GCCCAGAGGGATCCCAGAGTGGG - Intergenic
1084426529 11:69087152-69087174 GGCCTCTGGGGTCCCAGCAAGGG - Exonic
1084877788 11:72146346-72146368 GGCCACAAGGGTCCCACCAAGGG + Intergenic
1084883036 11:72185690-72185712 GGCCACAAGGGTCCCACCAAAGG + Intergenic
1085468605 11:76741510-76741532 TGCCACAGGGCACGCAGAGAGGG - Intergenic
1089399536 11:118156516-118156538 GGCAACAGGGGAGCCAGAGTGGG - Intergenic
1089579236 11:119471096-119471118 GACCACAGGGATCACAGAGAAGG - Intergenic
1089783906 11:120894544-120894566 GGCCCCAGGGGTTGCAGTGAAGG - Intronic
1089848854 11:121479983-121480005 GTCCCCAGGACTCCCAGAGAGGG + Intronic
1089852549 11:121513035-121513057 GGCCAAAGGAGACCCAGAGCTGG - Exonic
1091384396 12:83596-83618 GGCCAGAGGGGAGCAAGAGAGGG + Intronic
1091789602 12:3264237-3264259 GGGCACAGGGGACCCGGGGAAGG + Intronic
1091952201 12:4603506-4603528 GGCGGCTGGGGTCACAGAGACGG + Intronic
1092490557 12:8941031-8941053 TGCCACAGGGGTTCCAGAAAAGG - Exonic
1092788136 12:12048417-12048439 GGCCACAGTGGCCCATGAGAGGG - Intergenic
1092906092 12:13101544-13101566 GGCCACATGTGTCCCGGAGCTGG + Intronic
1094494323 12:30979937-30979959 GGCCACAGAGGCCCCAGAACGGG - Intronic
1096124118 12:49107222-49107244 GGCCCCAGGGGCCTCAAAGAAGG + Intronic
1096945932 12:55410127-55410149 TGCCACAGGGGTTCCAGAAAAGG + Intergenic
1097103116 12:56603524-56603546 GGCCGCAGGGGTCGAAGAGATGG - Exonic
1097452950 12:59757696-59757718 TGACTCAGGGGTGCCAGAGATGG - Intronic
1099874086 12:88382975-88382997 GGCTATAGGGGTCCCAGCAAGGG - Intergenic
1102290168 12:111692789-111692811 GGCACCAGGGGTCCCACCGATGG + Exonic
1102954657 12:117051727-117051749 GGTCACAAGGTTCCCAGAGAAGG - Intronic
1103049595 12:117767911-117767933 TGCCACTGGCCTCCCAGAGAGGG + Intronic
1103055280 12:117814984-117815006 GGCCAAAGGGCTCACAGAAAGGG + Intronic
1103134761 12:118497986-118498008 GGCCAGAGGGGAGCCAGAGTGGG - Intergenic
1103917479 12:124383552-124383574 GGCCTCAGGTGGCCCTGAGAAGG + Intronic
1104237986 12:126958239-126958261 GTCTACAGAGGTCCCAGAGGTGG + Intergenic
1104374826 12:128255632-128255654 GGCCAGAGAGGTGCCAGTGAAGG + Intergenic
1104643306 12:130480968-130480990 GGACACACGCGTCCAAGAGAAGG + Intronic
1104788648 12:131468261-131468283 TGTCACAGGGGTCCCAGACCTGG - Intergenic
1104968518 12:132520699-132520721 GGACAGAGGGGCCCCAGAGTCGG + Intronic
1105255830 13:18743637-18743659 GGCCACAGGGGTCCCTGGGGAGG + Intergenic
1106161112 13:27202171-27202193 GGCCACATGGGGACAAGAGAGGG - Intergenic
1106382809 13:29256431-29256453 AGCCAGAGGGGCCACAGAGAGGG + Intronic
1108228869 13:48317789-48317811 GGCCAGGGGGGTCCCACAGCCGG - Intronic
1109668289 13:65568124-65568146 GGACAAAGAGGTCACAGAGAGGG - Intergenic
1113886168 13:113659408-113659430 GGTTACACGGGTCCCTGAGAGGG - Intergenic
1115797888 14:36959511-36959533 GGCCTGAGGGTTCCTAGAGAGGG + Intronic
1118718370 14:68576261-68576283 AGCCCCAGGGGTCACAGAGCAGG + Intronic
1121119420 14:91366809-91366831 AGCCTCAGAGGTCCCAGAAAAGG + Intronic
1121489583 14:94348340-94348362 GTGCACAGGGGTTTCAGAGATGG - Intergenic
1121691467 14:95880476-95880498 TGCCACATGGATCCTAGAGAGGG - Intergenic
1122122589 14:99562299-99562321 GCCCTCAGGGGTGCCAGAGGAGG - Intronic
1122613318 14:103000528-103000550 AGGCACAGCGGCCCCAGAGATGG - Intronic
1122871918 14:104642624-104642646 GCCCACGGTGGTCCCAGAGGAGG + Intergenic
1122974755 14:105166496-105166518 GACCAGGGGGGCCCCAGAGAGGG - Intronic
1123107109 14:105846811-105846833 GCCCAGAGGGGTCCAAGAGGTGG - Intergenic
1124109971 15:26775956-26775978 GGCTCCAGGAGTCCCACAGAGGG + Intronic
1124178992 15:27455883-27455905 AGCCCCAGGGGTCCCAGAATTGG - Intronic
1124683347 15:31756430-31756452 TGCCACTGTGGTCCCAGAGAAGG + Intronic
1125125869 15:36220321-36220343 GGACACAGTGGTGCCAGTGAGGG + Intergenic
1127857693 15:62966262-62966284 GGGCACAGAGGTCTAAGAGATGG - Intergenic
1128544105 15:68555826-68555848 AGGCACAGGGGTCCCACAGGAGG + Intergenic
1128938141 15:71765473-71765495 GGCCACAGTTGGCCCAGAGTTGG - Intronic
1129198055 15:73982750-73982772 AACCCCAGGGGCCCCAGAGAAGG - Exonic
1129226961 15:74175730-74175752 GGCCACAGGGGTGCCAGGCAGGG - Exonic
1129704687 15:77787494-77787516 GGACACAGGGGTCCCGGTGGAGG + Intronic
1129884883 15:79031041-79031063 GGCCATAGGAGGCCCAGAGGGGG - Intronic
1129966124 15:79737424-79737446 GGGAACAGTAGTCCCAGAGAAGG + Intergenic
1130330586 15:82919065-82919087 GGCCACAGGAGTCCCAGGGCTGG + Intronic
1130550554 15:84887792-84887814 GGCCACAGGTGTGAGAGAGATGG - Exonic
1130846991 15:87756809-87756831 AGGCACAGGGATCCCAAAGAGGG - Intergenic
1131046345 15:89318885-89318907 GGGCAGAGGGGCCCCAGGGAGGG - Intronic
1131120970 15:89823356-89823378 GCCCACAGAGGTCCCTGAGGTGG + Intergenic
1131352705 15:91716245-91716267 GGCCTCAAGGGTCCTAGATAAGG + Intergenic
1132859587 16:2063475-2063497 GGCCACAGAGCTCCCAGAGGAGG - Intronic
1132863198 16:2081524-2081546 GGCCCCTGGGGGGCCAGAGATGG + Intronic
1133046835 16:3092746-3092768 GGCCACGGGCGTCCCTGAGCCGG - Exonic
1133749400 16:8712989-8713011 GTCCACAGGGGGCCCAGAAGAGG - Exonic
1136024551 16:27461337-27461359 GCCCACAGGGGTCCTAGAGGTGG + Exonic
1137327919 16:47460714-47460736 GGCCACAGGGCTGGGAGAGAAGG + Intronic
1137494890 16:48962048-48962070 GGCAATAGGAGTCCCAGAGAAGG - Intergenic
1138205358 16:55120452-55120474 AGTCACAGGGGTAGCAGAGATGG - Intergenic
1138265403 16:55656513-55656535 GGACGCAGGGTTCCCAGAAAAGG - Intronic
1138454204 16:57112194-57112216 GGAAACAGGGGCCCCAGAGTGGG + Intronic
1139851315 16:69952732-69952754 GGCTGCTGGGGTCCCAGACAAGG - Intronic
1139923874 16:70475178-70475200 GGCCTCTGGGCTCCCAGACAGGG - Intronic
1140539620 16:75744770-75744792 GGCCACAGGGGTCCTGCTGAGGG + Intronic
1142005890 16:87689454-87689476 GACCACGGGGGTCCCACAGAGGG + Intronic
1142223290 16:88865602-88865624 CTCCTCGGGGGTCCCAGAGAGGG + Exonic
1142995454 17:3757388-3757410 GGGCACAGGGGAGGCAGAGAGGG - Intronic
1143096409 17:4480767-4480789 GGCCACAGGGAGCCCTGAGGTGG - Intronic
1143449517 17:7027496-7027518 GGCCACAGGGGTCGCACTGTGGG - Exonic
1144867662 17:18347271-18347293 GGCCACAGGGAAACCAGTGAGGG - Intronic
1145252832 17:21305728-21305750 GTCCACAGGGGAGCCAGAGCGGG - Intronic
1145294228 17:21575236-21575258 GGCCACAGAGGTCACAGGTAGGG + Intergenic
1145323743 17:21782188-21782210 GTCCACAGGGGAGCCAGAGCGGG + Intergenic
1145369603 17:22297950-22297972 GGCCACAGAGGTCACAGGTAGGG - Intergenic
1146499970 17:33355921-33355943 GGGAAAAGGGATCCCAGAGAAGG + Intronic
1146505336 17:33399830-33399852 GGCCACACTGAACCCAGAGACGG - Intronic
1147478854 17:40739945-40739967 GGCCACTTGAGCCCCAGAGATGG - Intergenic
1148046940 17:44750035-44750057 GGCGAGAGGGGTCCCAGAGGGGG - Intronic
1148245277 17:46026173-46026195 GGCCACACGAGTCCCAGTGTGGG - Exonic
1148836553 17:50468810-50468832 GGCCCCAGGCGTCCCAGCCATGG - Exonic
1149512925 17:57257293-57257315 GGCAACAGAGGTCGCATAGAGGG - Intronic
1149684759 17:58528940-58528962 GGCCACAGGGGCTCTAGACAAGG + Intronic
1150108684 17:62479341-62479363 GGCCAAAGGGGTCCCCAGGACGG - Intronic
1150573516 17:66409361-66409383 GTCCACAGGAGTCCAAGACAAGG - Intronic
1151530700 17:74703007-74703029 GGCCACAGTGGAACCAGAGCTGG + Intronic
1152087690 17:78230759-78230781 TGCCACATGGCTCCCAGAGAGGG + Intergenic
1152460882 17:80441773-80441795 GGCCCCAGTGGCCCCAGCGAAGG + Intergenic
1152502031 17:80718628-80718650 GGCAACAGTTGTCCCTGAGAGGG + Intronic
1152559983 17:81073071-81073093 GGCCACCAGGGCCCCAGAGCAGG - Intronic
1152645321 17:81465958-81465980 AGCCACTGGAGTTCCAGAGAGGG + Exonic
1152784606 17:82241270-82241292 AGGCACAGGGGACCCAGAAAGGG + Intronic
1152993923 18:388736-388758 GGCCACCCAGGTCCCAGAGCTGG + Intronic
1153479817 18:5535920-5535942 GGTCACTGGGCTCCCAGAGATGG - Intronic
1154165625 18:12012244-12012266 GGCCAGAGGGAGCCCAGGGAGGG - Intronic
1154434782 18:14335195-14335217 GGCCAGAGTGGTCGGAGAGATGG + Intergenic
1154435194 18:14337037-14337059 GGCCACAGGGGTCCCTGGGGAGG - Intergenic
1156125832 18:33904200-33904222 TGCCATAGGGGTCCCATCGAGGG + Intronic
1157565334 18:48675710-48675732 GTTCCCAGGGGTCCCAGGGAGGG - Intronic
1160030252 18:75250750-75250772 GGCCACAGGTCACCCAGAGCGGG + Intronic
1160897621 19:1410022-1410044 GGCCACAAGTGTCCCAGAACAGG - Intronic
1160961788 19:1725456-1725478 GGCCGCAGGGGCCCCACAGTCGG - Intergenic
1161021742 19:2014388-2014410 GGTCACAGGAGTCCCAGGGGTGG + Intronic
1161089380 19:2352518-2352540 GGGCTCATGGGTCCCACAGATGG + Intronic
1161241843 19:3227287-3227309 GCCCAGAGAGGGCCCAGAGAGGG - Intronic
1161280168 19:3441651-3441673 GGCCAGAGGGGCCCAAGGGAAGG + Intronic
1161399013 19:4059416-4059438 GGGAACAGGGGCCCAAGAGAGGG - Intronic
1161436693 19:4267779-4267801 GGTCACAGAGTTCCCAGAGCCGG + Intronic
1161627735 19:5337002-5337024 GGAGACAGGGGTCCCAGAAAGGG - Intronic
1162548108 19:11343162-11343184 GGCCAGAGGGGCCCTAGGGAGGG + Intronic
1163333900 19:16659591-16659613 GGGCAGTGGGGGCCCAGAGAAGG - Intronic
1163389434 19:17021440-17021462 AGCCACAGGAGACACAGAGAAGG - Intronic
1163420038 19:17209233-17209255 GGCCCCAGGGGCTCCAGACATGG - Intronic
1163729282 19:18940349-18940371 GGCCACGGGGCTCCCGGAGGGGG + Intronic
1163795417 19:19335076-19335098 GGGCACAGTGGTCCCTGAGTTGG + Intronic
1165901878 19:39173085-39173107 GGCCAGAGGGGGCCCAGGGAAGG + Exonic
1166224031 19:41383886-41383908 GGCCTCAGGGTTCACAGTGAGGG - Exonic
1166959886 19:46491003-46491025 AGCCACAGGAGACACAGAGAGGG + Intronic
1167293447 19:48636537-48636559 GACCCCTGGGGTCCCAGGGAGGG - Intronic
1167374327 19:49103037-49103059 GCACACAGGGGTCCAGGAGACGG - Intronic
1168258053 19:55178028-55178050 GGACTCTGGGGACCCAGAGATGG - Intronic
1168319227 19:55499375-55499397 GGCCACGGGGGCACCACAGAAGG + Intronic
1168338073 19:55607733-55607755 GGCCACAGTTGTCCAGGAGAAGG - Intronic
1202711217 1_KI270714v1_random:20326-20348 GGCCACAGGGGAGCTGGAGAAGG - Intergenic
924976737 2:184264-184286 GGCCAAAGGGGTCCCACTGAGGG + Intergenic
925741079 2:7006631-7006653 GGTCCCAGAGGTCCCAGTGAGGG - Intronic
927969890 2:27298883-27298905 TGCCTCAGGCCTCCCAGAGAGGG + Intronic
929557520 2:42934807-42934829 GGCCATAGTGGACTCAGAGAGGG + Intergenic
929690551 2:44068949-44068971 GGCCAGACTGGTCACAGAGAGGG + Intergenic
931756456 2:65378984-65379006 GGCCAAGGGGGTCCCAGGAAAGG - Intronic
934490829 2:94761196-94761218 GGCCACAGGGGTCCCTGGGGAGG + Intergenic
934491253 2:94763114-94763136 GGCCAGAGTGGTCGGAGAGATGG - Intergenic
934662427 2:96150251-96150273 GGCCACAGGTGTGCCAGGGGTGG - Intergenic
937868594 2:126771784-126771806 GGCCACAGGGAGCACAGAGTAGG + Intergenic
937955536 2:127420029-127420051 GGCCACAAGGGTCCCGGGGTAGG - Intronic
938278752 2:130050345-130050367 GGCCACAGGGGTCCCCAGGGAGG + Intergenic
938329726 2:130441204-130441226 GGCCACAGGGGTCCCCAGGGAGG + Intergenic
938360220 2:130680299-130680321 GGCCACAGGGGTCCCCAGGGAGG - Intergenic
938436623 2:131287007-131287029 GGCCACAGGGGTCCCCAGGGAGG - Intronic
939511769 2:143115441-143115463 GGCCACATAGTTCCCAGAAACGG - Intronic
940500071 2:154482752-154482774 GGAAACAGGAGTTCCAGAGAGGG + Intergenic
943002832 2:182350759-182350781 GGCCAGAGCAGTGCCAGAGAAGG + Intronic
943440543 2:187922585-187922607 GGCCATAGGAGTCCCACTGAGGG + Intergenic
945598604 2:211828867-211828889 GGCAACAGTGCTCCCAGAAAAGG - Intronic
946153915 2:217794498-217794520 GGCCACAGGGAGGCCAGAGCGGG - Intergenic
947671443 2:231939027-231939049 CGCCTCTGGGGCCCCAGAGATGG - Intergenic
947837766 2:233187931-233187953 GGCCCTAGGGGTCCCTGAGCTGG - Intronic
948798951 2:240421504-240421526 GGCTACAAGGATCCCAGAGGGGG + Intergenic
948806893 2:240456920-240456942 GGCCCCAGGGCTCTCAGAGCCGG + Intronic
1169178011 20:3536054-3536076 GGACACAGTGGGTCCAGAGAAGG - Intronic
1170597906 20:17819267-17819289 GGCCAGAGGAGGGCCAGAGAAGG + Intergenic
1171215727 20:23350853-23350875 GGTCACCGGGGCCCCAGAGCCGG - Exonic
1171252669 20:23661224-23661246 GGACACTGGAGGCCCAGAGAAGG + Intergenic
1171883000 20:30631749-30631771 GGCCAGAGTGGTCAGAGAGAGGG - Intergenic
1172044314 20:32069273-32069295 GGCCACAGGGTCCCGAGGGAGGG - Intronic
1173549923 20:43925601-43925623 GGGCACAGGGGTCCCAGCGCAGG + Intronic
1173918398 20:46726217-46726239 GGGCAGAGGGGGCCCAGGGAGGG - Exonic
1174059368 20:47821720-47821742 GGCCACAGGGGACTCTGGGATGG + Intergenic
1174181875 20:48680062-48680084 AGCCAGAGGGGTCCCAGTGCAGG - Intronic
1175031919 20:55963228-55963250 GGCTAGTGGGGTTCCAGAGAGGG - Intergenic
1175174411 20:57102353-57102375 GGCCTCAGGAGCCCCAGCGATGG - Intergenic
1175175986 20:57112422-57112444 GGCCAAAGTGGACCCAGAAATGG - Intergenic
1175455861 20:59113332-59113354 GCTCACAGGTGTCCCAGGGATGG + Intergenic
1175934123 20:62507350-62507372 GGCCAGGGAGGTCCCAGTGATGG + Intergenic
1176030066 20:63007456-63007478 GGCCACAGGGCGCCCCGAGCAGG - Intergenic
1176295618 21:5070519-5070541 GGCCCCAAGGGACCCAGACAAGG - Intergenic
1176663763 21:9664473-9664495 GGCCTCAGGCAGCCCAGAGAGGG + Intergenic
1176841843 21:13848664-13848686 AGCCACAGGGGTCCCTGGGGAGG + Intergenic
1176924395 21:14729962-14729984 TCCCACAGGGGTGACAGAGAGGG + Intergenic
1177338115 21:19760024-19760046 GGTCCCCGGGGTCCCAGAGATGG - Intergenic
1179861431 21:44191605-44191627 GGCCCCAAGGGACCCAGACAAGG + Intergenic
1180144362 21:45910966-45910988 GGCATCTGGGGTCCCCGAGATGG - Exonic
1180999932 22:19983285-19983307 GGCCCCAGGGGGCCCAGGCAAGG - Intronic
1181004024 22:20001186-20001208 GGCCTCAGGGGTCTCAGAGGGGG - Intronic
1182718526 22:32378716-32378738 CCCCACAGGGGCCCCAGATATGG + Intronic
1183282018 22:36937204-36937226 GGGAGCAGGGGCCCCAGAGAAGG - Intronic
1183776495 22:39969547-39969569 TTCCCCAGGGATCCCAGAGAAGG - Intronic
1184286730 22:43476238-43476260 GGCCACAGGGTGCCCAGTGCTGG + Intronic
1184829450 22:46974970-46974992 AGCCACAGGTCTCCCAGTGACGG + Intronic
1184856838 22:47150893-47150915 GGCCACAGAGTTCCCACGGAAGG - Intronic
1184887481 22:47355264-47355286 GGCCACCGAGGTCCCCGAGGAGG - Intergenic
1185039146 22:48495571-48495593 GGGCACAGGGAGCCCAGGGAAGG - Intronic
1185163650 22:49244564-49244586 GGCCAAAGGGGTCCCAGGACTGG + Intergenic
1185255266 22:49827990-49828012 GGCCAAAGGGGGCCCTGAGGCGG + Intergenic
1185273072 22:49937509-49937531 TGCCACAGGAGACCCAGTGAGGG - Intergenic
1185412166 22:50688501-50688523 GCCCACTGGGGTCCCAGAGTGGG + Intergenic
949759624 3:7455109-7455131 ATCCACTGGGGTCCCAGAGTTGG - Intronic
949878111 3:8640127-8640149 GGTGAAAGGGGTTCCAGAGAAGG + Intronic
950099110 3:10346341-10346363 GGCCACAGGGGGCCCCAAGTCGG - Intronic
950111027 3:10418846-10418868 GGCCACCGGGGTAGCAGTGAGGG + Intronic
950410447 3:12832927-12832949 GGCTCCAGGGGTTTCAGAGAAGG + Intronic
950538368 3:13594854-13594876 GGCCAGAGGGGTGGCAGGGAGGG + Intronic
950658165 3:14450197-14450219 GGACCCAGGGGTCTTAGAGAGGG + Intronic
950678031 3:14566296-14566318 GGCCACAGAGCTCCCAGGGATGG + Intergenic
954294274 3:49665480-49665502 GGCCACAGAGCTGCCTGAGATGG + Intronic
954303293 3:49712721-49712743 GGCCACAGAGGTCTCAGACCAGG - Intronic
954581361 3:51704492-51704514 GGCCACTGGGGTCACAGAGCAGG - Intergenic
954711007 3:52505115-52505137 ATCCCCAGGGGTCCCAGAGGGGG - Exonic
954940878 3:54372069-54372091 GGCCCCAAGGGCCTCAGAGATGG + Intronic
956883677 3:73536837-73536859 GGTCACGGGGGTCGCAGAGGTGG + Intronic
956894746 3:73648525-73648547 GGCCAAGGGGGTCCCAGCGGTGG - Intergenic
960137651 3:114122031-114122053 GGATACATGTGTCCCAGAGAGGG - Intergenic
961205821 3:125080751-125080773 GGTCTCAGGGCTTCCAGAGATGG - Intergenic
961663340 3:128481839-128481861 GGCCACAGGCGTTGCAGACAGGG + Exonic
964255042 3:154766490-154766512 GGCCATAGGTGGCCCAGAAAAGG + Intergenic
965087217 3:164114051-164114073 GGCCACAGGCAGCCCAGAAAAGG - Intergenic
966354839 3:179068969-179068991 GGACTGAGGTGTCCCAGAGAAGG - Intronic
966807681 3:183819451-183819473 GGCTGCAGGGGTCTCAGAGCAGG + Intronic
966880469 3:184347081-184347103 GGCCACAGGGGCCCAGGACAAGG + Intronic
966994538 3:185266954-185266976 TGCCACAGGGTTCCCACTGAAGG + Intronic
968000129 3:195199803-195199825 GGACACATGGGACCCAGGGAAGG - Intronic
968581902 4:1399144-1399166 GGCCACACGGGGTCCAGGGAGGG + Intergenic
969317463 4:6390740-6390762 GGCCACCGGGGTCACAGATCAGG + Intronic
969372607 4:6743340-6743362 GGCCCTAGGGTTCCCAGAGCAGG + Intergenic
969665937 4:8557703-8557725 GGGCACAGGTGTCCCAGAGCTGG - Intergenic
971878723 4:32340276-32340298 GGCCATAGGGGTCCCACTGAGGG + Intergenic
974136536 4:57825365-57825387 GGCCATAGGGGTCCCACTGAGGG - Intergenic
976257008 4:83109829-83109851 AGACCCAGGGGTCCCAGAGCTGG - Intronic
977942573 4:102874899-102874921 GGCCACAGGAATAGCAGAGAGGG - Intronic
979919341 4:126478741-126478763 GACCTCTGGGGCCCCAGAGAGGG - Intergenic
983181778 4:164656680-164656702 GGCCTCAGGGATCCCAGTGAGGG - Intergenic
984951942 4:185014579-185014601 GGCAGCAGGTGTCCCACAGAAGG + Intergenic
990323237 5:54649435-54649457 GGCCTCAGCAGTCCCAGGGAAGG + Intergenic
991643463 5:68777144-68777166 TGCCCCAGGGGTTCCTGAGAGGG - Intergenic
992048811 5:72925433-72925455 GGCCTCAGGCAGCCCAGAGAGGG - Intergenic
995064591 5:107845710-107845732 GGAGACAGTGGCCCCAGAGAGGG + Intergenic
995940728 5:117580175-117580197 GGCCAAGGGGTTGCCAGAGAGGG - Intergenic
996038055 5:118780866-118780888 GGCCATAGGGTTCCCACTGAGGG + Intergenic
998311304 5:141135821-141135843 TGCCCCAGAGTTCCCAGAGAAGG + Exonic
998421129 5:141987432-141987454 GGCCATAGGGGTCCCACTGAGGG - Intronic
999086930 5:148900950-148900972 GCCAACAGAGGTCTCAGAGAAGG + Intergenic
1001492787 5:172167514-172167536 ATCCACAGGGGTCCCAGCGAGGG + Intronic
1002197827 5:177510666-177510688 GGCCACAGTGGGCACAGAGCTGG - Intronic
1002204286 5:177552626-177552648 TCCCACGGGGGTCCCAGAGTAGG + Intronic
1002641118 5:180631052-180631074 ACCCACTGGGGCCCCAGAGATGG - Intronic
1002719183 5:181247344-181247366 TGCCTCTGGGGTCCCAGACACGG - Intronic
1003641931 6:7883052-7883074 GGCCACTGGGTTCCCAGTGGTGG - Exonic
1003984026 6:11417413-11417435 GGCCTCAGCTGGCCCAGAGAGGG + Intergenic
1005017557 6:21388411-21388433 AGCCACAGGAGGCCCAGAGGAGG + Intergenic
1005582356 6:27247353-27247375 GGCAACTGGGGTTCCAGAGGAGG + Intergenic
1006459480 6:34150081-34150103 GGCCCCAAGGGTCTCAGATAAGG + Intronic
1006939484 6:37742479-37742501 GGCCTCAGGGGTCCCCCAGCTGG - Intergenic
1007230694 6:40345806-40345828 GGCCACAGGAGCCACAGAGGAGG + Intergenic
1007357367 6:41331547-41331569 GTCCACAGGAGCCCCTGAGAAGG + Intergenic
1007363367 6:41373707-41373729 GGCCACCGTGGGCCCACAGAGGG + Intergenic
1007739245 6:44000947-44000969 GGCCACAGGGGCCAAAGAGGGGG - Intronic
1007788861 6:44297594-44297616 GGCCAGAGGGGGCCCCGATAAGG + Intronic
1007823543 6:44580066-44580088 GGGGACAGGGGCCCCAAAGAAGG + Intergenic
1010983565 6:82396840-82396862 GTTCACTGGGGACCCAGAGATGG - Intergenic
1012121767 6:95377766-95377788 GGCCACAGTGGAAGCAGAGAGGG - Intergenic
1016306790 6:142693281-142693303 ACCCCCAGGGGTCCCAGGGAAGG + Intergenic
1016561511 6:145400119-145400141 GGCCACAGGGGTCCCACAGATGG + Intergenic
1019010377 6:168839850-168839872 GGCCACAGGCGTCTGAGAGACGG + Intergenic
1019292164 7:256111-256133 GCCCACGGGGGTGGCAGAGATGG + Intronic
1019438311 7:1032935-1032957 GCTCACAGGTTTCCCAGAGAGGG - Intronic
1019831289 7:3333657-3333679 AGCCACATGGGTACAAGAGAAGG - Intronic
1019993700 7:4709543-4709565 GTGCACAGGGCTCCCGGAGAAGG - Intronic
1022674078 7:32482087-32482109 GGCCACCTGGGTGCCAGTGAAGG + Intergenic
1023045985 7:36210584-36210606 GGCCACACAGGTCCCAGGGAAGG - Intronic
1023667843 7:42543149-42543171 GGCCATAGGGGTCCCATTGAGGG - Intergenic
1023940022 7:44763280-44763302 GGGCCCAGGGGTGCCAGGGATGG - Exonic
1023969376 7:44979697-44979719 GGGCACAGGGGTCCCACTGAAGG - Intergenic
1024148588 7:46543469-46543491 GGCCACAGGGGTCTCCCTGAGGG + Intergenic
1025210500 7:57017469-57017491 CCCCAGAGGGGACCCAGAGAGGG - Intergenic
1025235534 7:57232263-57232285 GGCCACAGGGGACTCTGGGATGG - Intergenic
1025661456 7:63559378-63559400 CCCCAGAGGGGACCCAGAGAGGG + Intergenic
1026157816 7:67842601-67842623 GGACAGAGGGGTGTCAGAGATGG + Intergenic
1028740869 7:94273622-94273644 GACCACAGGGGTCCCAGTGGAGG + Intergenic
1030091606 7:105863276-105863298 GGCCACAGAGGCCCCAAAGCTGG + Intronic
1030303306 7:107995685-107995707 GGCCACTGGAATTCCAGAGATGG + Intronic
1031069556 7:117146601-117146623 GGCCAGAGTGGTAGCAGAGAAGG + Intronic
1032006313 7:128304804-128304826 GGCCACTGTGGTACCAGAGGAGG + Exonic
1032037703 7:128531851-128531873 GGCCAAAAGGGTCCCCGGGACGG - Intergenic
1035047868 7:155981048-155981070 AAACACAGGGGACCCAGAGATGG + Intergenic
1035211525 7:157332254-157332276 GGCCACAGGGGTGCGAGGCATGG - Intergenic
1036452132 8:8878077-8878099 GCCATCAGGGGTCTCAGAGAAGG - Intronic
1037892062 8:22628734-22628756 GGCCACAGGGGTCCCAGAGACGG - Intronic
1041247339 8:55901480-55901502 GGCCACAGGTGTGCAAAAGAAGG - Intronic
1042560889 8:70071445-70071467 CGCCACTAGGGTCCCAGGGAGGG - Intronic
1043084249 8:75808645-75808667 GGCCAGATGTGTTCCAGAGATGG + Intergenic
1045036235 8:98178518-98178540 TGACACAGGTGTCCCAGAGATGG - Intergenic
1047191219 8:122680856-122680878 GCCCACAGGGATCCCAGGGTGGG - Intergenic
1049531952 8:143159439-143159461 GGTCGCAGGGGTCCCGGAGGGGG + Intronic
1050592277 9:7173199-7173221 GGCCACAGGAGTCCCAAAGAAGG + Intergenic
1052095212 9:24375358-24375380 AGCCACATGGGTCCCAGGGAGGG - Intergenic
1052881293 9:33602315-33602337 GGCCACAGGGGTCCCCAGGGAGG - Intergenic
1053437755 9:38088141-38088163 GGCCACAAGGGGGCGAGAGAGGG + Intergenic
1053495025 9:38543527-38543549 GGCCACAGGGGTCCCCAGGGAGG + Intronic
1053667169 9:40324498-40324520 GGCCACAGAGGTCCCCGGGGGGG - Intronic
1054378313 9:64464526-64464548 GGCCACAGAGGTCCCCGGGGGGG - Intergenic
1054517441 9:66051785-66051807 GGCCACAGAGGTCCCCGGGGGGG + Intergenic
1056920153 9:90780297-90780319 GGCCATAGGCGTCCCACTGAGGG - Intergenic
1057129267 9:92641886-92641908 AGTAACAGGGGTCCCAGGGAGGG + Intronic
1058446314 9:105058302-105058324 GGCCATAGGGGTCCCACCAATGG + Intergenic
1059282733 9:113148826-113148848 GGACATCGAGGTCCCAGAGACGG + Intergenic
1060842405 9:126804262-126804284 GGGCACTGGGGTCACACAGATGG - Intergenic
1060870497 9:127035999-127036021 AGCCACAGAGCTCCCAGAGGAGG + Intronic
1060892643 9:127198511-127198533 GGCCAGTGGGGTCACAGAGAGGG - Intronic
1060970430 9:127734637-127734659 GGACACAGGAGTCCCAGACCAGG - Intronic
1062040516 9:134402289-134402311 GGCCAAAGGGCCCCCAGGGAAGG + Intronic
1062168551 9:135121599-135121621 GGAGATACGGGTCCCAGAGAGGG - Intergenic
1062381026 9:136286564-136286586 AGCTCCAGGGATCCCAGAGAGGG + Exonic
1062520465 9:136955583-136955605 GGCCATAGTGTGCCCAGAGAAGG - Intronic
1062696848 9:137880006-137880028 GGCCAGAGGCGTCCAGGAGACGG + Intronic
1186534239 X:10330292-10330314 GGCCACAGGTGACCAAGAGGAGG - Intergenic
1186548556 X:10477683-10477705 GGCCCCATGTGTCCCAGACATGG - Intronic
1187452175 X:19408190-19408212 GGTCACATGGGTCCCGGGGAGGG + Intronic
1192846040 X:74907998-74908020 GACCACAAGGGGCCCAGAGGAGG - Intronic
1193234725 X:79092922-79092944 GGGGGCAGGGGTCACAGAGATGG - Intergenic
1193383906 X:80848278-80848300 GGCCCTAGGGGTCCCACTGAGGG - Intergenic
1198817598 X:140608883-140608905 GGCCACAGTGGTGCAAGAGTTGG - Intergenic
1199878444 X:151953885-151953907 AGTCACAGGGGTCAAAGAGAAGG + Exonic
1202258539 Y:22944986-22945008 GGCCACATGTGTCCCACAGCTGG + Intergenic
1202411528 Y:24578744-24578766 GGCCACATGTGTCCCACAGCTGG + Intergenic
1202459254 Y:25091328-25091350 GGCCACATGTGTCCCACAGCTGG - Intergenic