ID: 1037892064

View in Genome Browser
Species Human (GRCh38)
Location 8:22628746-22628768
Sequence TTTCTGTGCCAGGGCCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1037892064_1037892072 -5 Left 1037892064 8:22628746-22628768 CCCCTGTGGCCCTGGCACAGAAA 0: 1
1: 0
2: 2
3: 46
4: 345
Right 1037892072 8:22628764-22628786 AGAAAAGCCCTCTGTGGGCAGGG No data
1037892064_1037892070 -10 Left 1037892064 8:22628746-22628768 CCCCTGTGGCCCTGGCACAGAAA 0: 1
1: 0
2: 2
3: 46
4: 345
Right 1037892070 8:22628759-22628781 GGCACAGAAAAGCCCTCTGTGGG No data
1037892064_1037892071 -6 Left 1037892064 8:22628746-22628768 CCCCTGTGGCCCTGGCACAGAAA 0: 1
1: 0
2: 2
3: 46
4: 345
Right 1037892071 8:22628763-22628785 CAGAAAAGCCCTCTGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1037892064 Original CRISPR TTTCTGTGCCAGGGCCACAG GGG (reversed) Intronic
900373107 1:2341027-2341049 TAGCAGTGCCAGGGCCAGAGGGG - Intronic
900375112 1:2350682-2350704 CTGCTGGGCCAGGGCCACTGGGG - Intronic
901557460 1:10042960-10042982 CTTCTGTGCAAGGGGCACAGTGG + Intronic
902258377 1:15205741-15205763 ATTCTGTGCCAGGCCCTCTGTGG - Intronic
904812850 1:33174855-33174877 TATCTGTGCCATGGCTACAGAGG - Intronic
904834250 1:33324668-33324690 TTTCTGTGGGAGGGGCAGAGAGG - Exonic
905273886 1:36804901-36804923 TGTATGTGCCAGGCACACAGTGG - Intronic
907564865 1:55425380-55425402 ATTCTGTGAGAGGACCACAGTGG + Intergenic
908406469 1:63818946-63818968 TTTTTGTTCCAGGGTCTCAGTGG + Intronic
908445005 1:64191640-64191662 TATCTGTGCCAAAGTCACAGGGG - Intergenic
908502210 1:64755029-64755051 GTTCTGTGCCTGGCCCAGAGTGG + Intronic
908926049 1:69256346-69256368 TTTCTGAGGCAGGCTCACAGTGG + Intergenic
909179120 1:72398204-72398226 TTTTAGTGCCACAGCCACAGAGG + Intergenic
911177877 1:94835006-94835028 TTTTTGGGACAGTGCCACAGAGG - Intronic
911225224 1:95297691-95297713 TGTCTGTGCCCGGCCCCCAGAGG + Intergenic
911648535 1:100360946-100360968 TTTCTGTGCCAGGTCACCACAGG + Intronic
913434435 1:118831982-118832004 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
915987430 1:160480880-160480902 TGTCTGTGCCATGCCCCCAGAGG + Intergenic
916279475 1:163033178-163033200 GTTCTGTGCTAAGGTCACAGAGG - Intergenic
917243238 1:172972239-172972261 GTTCTGTGCTTTGGCCACAGTGG - Intergenic
917335089 1:173917740-173917762 TGTCTGTGCCAGGGACACCTTGG - Intergenic
918208341 1:182328968-182328990 TCACTGTGCCAGGGCCCCATGGG + Intergenic
918299907 1:183193745-183193767 TTCCTATGCCAGGTCCACTGTGG - Intronic
919862354 1:201748713-201748735 TTACTGTGCCAGGGAGACAGTGG + Intronic
920353473 1:205353003-205353025 TTTCTGGGCCAGGACTAGAGAGG - Intronic
920706458 1:208254383-208254405 TTTCCATCCCAGGCCCACAGGGG - Intergenic
921599615 1:217092429-217092451 TTTCTGTGCCAAGGAAACTGAGG + Intronic
922452959 1:225751308-225751330 CTTCTGTGGCAGGGAGACAGTGG + Intergenic
922518504 1:226225593-226225615 TTTCAGTTCCAGGAGCACAGTGG - Exonic
922564643 1:226593729-226593751 GCTCTGTGCCAGGAACACAGTGG + Intronic
922749535 1:228064095-228064117 TGTCTGTGCTAGGGCCACAGTGG - Intergenic
922800998 1:228364720-228364742 CCTGTGTGCCAGGGCCACAGTGG + Intronic
924501830 1:244645401-244645423 TTTCTCTACCAGGGCCTCAACGG - Intergenic
924550238 1:245069440-245069462 TTGCTGTTCCAGGGTAACAGAGG + Intronic
1063006385 10:1975047-1975069 TTTCTGAGACAGGGCCTCAGTGG + Intergenic
1064905286 10:20339423-20339445 TGTCTGTGCCCTGCCCACAGAGG + Intergenic
1065798681 10:29331237-29331259 TTTCTGTTCCAGGACCACACTGG + Intergenic
1067273543 10:44813909-44813931 TTTCTGGGCCAGCTCCACACTGG + Intergenic
1070059364 10:72967481-72967503 TTTCTGGACCTGGGCCAAAGGGG - Intergenic
1070474037 10:76814787-76814809 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1070474143 10:76815578-76815600 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1071354331 10:84778691-84778713 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1071471415 10:85986618-85986640 AGTCTGTGCCAGGCCCACAGAGG + Intronic
1073227416 10:101934334-101934356 TTTTTGTTCCAGTGCCAAAGTGG - Intronic
1073242605 10:102067873-102067895 TTCCTGTGTCAGTGACACAGAGG - Exonic
1073323341 10:102628698-102628720 TGTCTCTGCCAGGACCAAAGTGG - Intronic
1073435064 10:103511246-103511268 AGTCTGTCCCAGGGACACAGGGG + Intronic
1074112363 10:110431610-110431632 TCTGTGTGCCAGGGCCACACTGG + Intergenic
1076040878 10:127247454-127247476 TTTCTTTGCCATGGCCCAAGAGG + Intronic
1076179795 10:128398276-128398298 TCTCTGTGACAGGGACACTGAGG - Intergenic
1076179823 10:128398502-128398524 TGTCTGTGCCATGAGCACAGTGG - Intergenic
1077921796 11:6647039-6647061 TTCCTGTCCCAGGGCCAGCGAGG + Intronic
1078859141 11:15231130-15231152 TTTCTTTTCCAAGGCCAGAGAGG - Intronic
1079141385 11:17812324-17812346 TTTCTCTGCCAGGGGCCCATGGG + Intronic
1082321596 11:50818797-50818819 TTTCTGTGCCCTGCCCACAGAGG + Intergenic
1083140273 11:60715674-60715696 TGTGTGTGCCAAGGCCCCAGAGG - Exonic
1084475046 11:69384183-69384205 TTTCTGTCCCAGCCCCCCAGCGG + Intergenic
1085233740 11:74994879-74994901 ATTGTGTGCCAGGGGCACATTGG + Intronic
1085311249 11:75518173-75518195 TCTCTCTGAAAGGGCCACAGAGG - Intronic
1085531487 11:77194686-77194708 TCTGTGTGCCAGGCACACAGAGG + Intronic
1085624474 11:78061488-78061510 TTTCTGTCTCAGGGCCCCTGTGG + Intronic
1086961012 11:92980101-92980123 TGTCTGTCCCATTGCCACAGAGG - Intronic
1089349891 11:117816302-117816324 CCTCGGAGCCAGGGCCACAGCGG - Intronic
1089400113 11:118159654-118159676 TGACTTTGCCAGGGCCATAGGGG + Intergenic
1089716813 11:120368115-120368137 TTGCTTTGGCTGGGCCACAGCGG + Intronic
1089738571 11:120566028-120566050 AATCTGAGCCAGGCCCACAGAGG + Intronic
1091920962 12:4304120-4304142 TTTCTCTCCATGGGCCACAGGGG + Exonic
1092759854 12:11799885-11799907 TGTCTGTCCCAGGGACCCAGAGG - Intronic
1093192924 12:16095642-16095664 TCTCTGTGCCAGAGATACAGTGG - Intergenic
1093283195 12:17222441-17222463 TTTCTGTGCCAGTGTCACACAGG - Intergenic
1094858419 12:34431543-34431565 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1095661491 12:44741874-44741896 TGTCTGTGCCCTGCCCACAGAGG - Intronic
1096616029 12:52834095-52834117 CACCTGTGCCGGGGCCACAGTGG + Exonic
1098404441 12:70109003-70109025 CTTCAGTGGCAGGGCCTCAGTGG - Intergenic
1104657222 12:130582270-130582292 TTTCTGTGCCTGGTACATAGTGG + Intronic
1104700506 12:130899864-130899886 TTTTTGTGCCAAGGCCACCAGGG + Intergenic
1105979937 13:25508788-25508810 TGTCTGCCCCAGGGCCCCAGGGG + Intronic
1106000106 13:25714236-25714258 TTTCTGTGTCCCGGCCACATTGG + Intronic
1106308699 13:28534697-28534719 TCTGAGTGCCGGGGCCACAGGGG + Intergenic
1106425534 13:29625262-29625284 TTCCTGTGACAGAGCCCCAGGGG + Intergenic
1107540993 13:41389005-41389027 GTTCTCTGCCAGGGCCACACTGG - Intergenic
1108464419 13:50700519-50700541 TTTCTGTCCCTGGGCCCCAGAGG + Intronic
1109466336 13:62737430-62737452 ATTCTGTGGCAAGACCACAGTGG + Intergenic
1110020822 13:70469235-70469257 TTTCTGTATCAAGGCCTCAGAGG - Intergenic
1112053771 13:95671147-95671169 TTTCTGGCCCTGGGCCAGAGGGG - Intergenic
1112113806 13:96331637-96331659 TTTCTGTGCCCTGCCCCCAGAGG + Intronic
1112245681 13:97730961-97730983 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1112900476 13:104352098-104352120 TTTCTGTGCAAGTCACACAGTGG + Intergenic
1112984730 13:105434383-105434405 TTTCTGTTCCAGGCTCACAATGG + Intergenic
1113025500 13:105936853-105936875 TTTCTGTGCCACTCCAACAGAGG + Intergenic
1113784882 13:112997208-112997230 TTCCTGGGCCAGACCCACAGTGG - Intronic
1116042560 14:39703169-39703191 TTTCTGTGCCCTGACCCCAGAGG + Intergenic
1117104575 14:52384727-52384749 TGTCTGTGCCATGCCCCCAGAGG - Intergenic
1119061658 14:71480872-71480894 ATTCTGTGCTAGGATCACAGTGG + Intronic
1120019716 14:79515050-79515072 TATCTGTGGCAGAGCCTCAGAGG + Intronic
1120483231 14:85078660-85078682 TTTTTGTACCAGTACCACAGTGG + Intergenic
1121076798 14:91075790-91075812 TCTGTGTGCCAGTGCTACAGAGG + Intronic
1122350788 14:101088763-101088785 GTTCTTGCCCAGGGCCACAGAGG + Intergenic
1122597026 14:102900701-102900723 CTTGTGTGCCAGGGTCGCAGTGG + Intronic
1122783429 14:104153369-104153391 TGTAGGTGCCAAGGCCACAGGGG - Intronic
1124217577 15:27820623-27820645 TTTCTGTTCCAGGACCCCATCGG - Intronic
1125573649 15:40740045-40740067 TTTCTCTGCCTGGGCCACAGAGG - Intronic
1125917887 15:43505677-43505699 TTACTATGTCTGGGCCACAGAGG - Intronic
1127485265 15:59412699-59412721 TTTCTGTGACAGGGTCACCCAGG - Intronic
1128084286 15:64875331-64875353 TTTCTTTGCCTGGGCCTCAAAGG + Intronic
1128873889 15:71186283-71186305 TTTGTGTGCCAGGGTGGCAGTGG + Intronic
1130924896 15:88377789-88377811 TTTCTGTGGCAGTGGGACAGGGG - Intergenic
1131259203 15:90879906-90879928 ATTCTGGGCCAGGGCCACCATGG - Exonic
1132640391 16:975632-975654 TGTCTGAACCAAGGCCACAGAGG + Intronic
1132783995 16:1644379-1644401 TTCCTGTGCCAGGCACACACAGG - Intronic
1133561645 16:6956095-6956117 TATCTGAGTGAGGGCCACAGAGG + Intronic
1134743082 16:16565525-16565547 TTTTTCTGCCAGGCCCACAGTGG - Intergenic
1134924478 16:18146935-18146957 TTTTTCTGCCAGGCCCACAGTGG + Intergenic
1135468865 16:22711745-22711767 TGTAGGTGCCAGGGCTACAGTGG + Intergenic
1135747294 16:25027960-25027982 TTCCTATGCCAGTGCCACACAGG - Intergenic
1136460626 16:30407963-30407985 TTGCTGGGCCAGGGCCACGGTGG + Intronic
1137015139 16:35366854-35366876 TTTCTGTACCCAGGTCACAGGGG - Intergenic
1139040865 16:62997933-62997955 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1139429013 16:66901151-66901173 GTTCTGTGCCAGGGCCTCGAGGG + Intergenic
1139633286 16:68243535-68243557 GTTCTGAGCCAGGGCCTTAGCGG + Intergenic
1140276115 16:73510329-73510351 TCTAGGTGCCAGGGACACAGTGG - Intergenic
1140481333 16:75264423-75264445 TCTCTGGCCCAGGGCCTCAGGGG - Exonic
1140982188 16:80121257-80121279 TTTCTGAGCCACGGGAACAGAGG - Intergenic
1141871475 16:86789448-86789470 TTTCTGTGGCAGGAACACACAGG - Intergenic
1142030454 16:87835939-87835961 GTTCTGTGTCAGGGCCAGGGCGG + Intronic
1142233682 16:88911462-88911484 TCCCCGTGGCAGGGCCACAGAGG - Intronic
1142261450 16:89044339-89044361 TTTCTTTGCAAGGACCACATGGG - Intergenic
1142402861 16:89870049-89870071 GGTCTCTGCAAGGGCCACAGTGG + Exonic
1142489655 17:270041-270063 TCTCTCTGGCAGAGCCACAGAGG + Intronic
1142692929 17:1617709-1617731 TTTCCTTGCCGGGGTCACAGTGG + Intronic
1144234015 17:13239241-13239263 TTTCAGTGCCAGGGACTCTGAGG - Intergenic
1144727719 17:17510294-17510316 TGTCTGTCCCAGGCCCACAGAGG + Intronic
1144939343 17:18926716-18926738 TCTCGGTGCCACAGCCACAGAGG + Intronic
1146460943 17:33045623-33045645 TTTCTGGGCCAGGGTCATGGCGG + Intronic
1147383814 17:40070582-40070604 TTTATGTGTCTGGGCCACGGTGG + Intronic
1147602541 17:41755211-41755233 TTTAGTGGCCAGGGCCACAGGGG + Exonic
1148713400 17:49698322-49698344 TTTCTCTGCCAGGGCATCCGGGG + Intergenic
1149287838 17:55185728-55185750 TGTGTGTGCCAGGACCACAGAGG + Intergenic
1152461820 17:80445677-80445699 TTCCTGGGCCAGGGGCTCAGGGG + Intergenic
1152587533 17:81195705-81195727 TCGGTGTGTCAGGGCCACAGCGG - Intronic
1152601362 17:81263863-81263885 CTTCTGTGCCAGAGCCAGGGCGG + Intronic
1152739753 17:82013701-82013723 CTCCTGGGCCAGGGCCACAGAGG - Intronic
1153019153 18:611119-611141 GGGCTGAGCCAGGGCCACAGAGG - Intronic
1153524308 18:5980024-5980046 TTTCTGTGCCAGGGACAAGCAGG - Intronic
1153531597 18:6051903-6051925 TATCTGTTCCAGCCCCACAGTGG - Intronic
1154340035 18:13495260-13495282 TTTCAGTTCCAGGGCCAGCGAGG + Intronic
1157081512 18:44530368-44530390 CTTGTCAGCCAGGGCCACAGGGG + Intergenic
1159014971 18:63093984-63094006 TGTCTGTGCCAGAGACACAGAGG + Intergenic
1160987100 19:1844124-1844146 CTTCTGTGCCCAGCCCACAGAGG + Intronic
1161220330 19:3115490-3115512 TGTGTGAGCCAGGGCCACACAGG + Intronic
1162573642 19:11486445-11486467 TGCCTGTTCCAGGCCCACAGAGG - Intronic
1162792895 19:13072185-13072207 TTTGTGTGCCAGGGGCACAACGG - Intronic
1163440428 19:17320023-17320045 TTACTGTGGCCGGGCGACAGGGG + Exonic
1163523412 19:17805741-17805763 TTACTGAGGCAGGTCCACAGGGG - Intronic
1163555903 19:17992854-17992876 GTTCTGTGCCAGCCCCTCAGGGG - Intronic
1163702904 19:18795506-18795528 TTTCTGTGGCAAGGACAGAGAGG - Intergenic
1164181186 19:22820154-22820176 TTTCTCTGCCATGCTCACAGTGG + Intergenic
1164295561 19:23906691-23906713 TTTCTGTGCCCTGCCCACATTGG + Intergenic
1165217760 19:34288742-34288764 TTTCTGTGCTAGGGCAACCATGG + Intronic
1166446581 19:42863114-42863136 TGTCTGTGCCTGGCCCACAGAGG + Intronic
927326356 2:21810182-21810204 CTTCTGTCCCTGTGCCACAGTGG + Intergenic
927509868 2:23637708-23637730 GTTCTGTGCCAGGGACAGAAAGG - Intronic
927861348 2:26562167-26562189 TTTCTGGGCCTGAGCCACGGTGG + Intergenic
928514694 2:32034677-32034699 TTTGTGTTCCAGTGACACAGGGG + Intronic
929800285 2:45093906-45093928 TGCCTGTGCCAGGGCAACTGTGG + Intergenic
931924655 2:67058116-67058138 GTTCTGTGCCAAGGCCAAATTGG + Intergenic
931935806 2:67195384-67195406 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
932638902 2:73421473-73421495 TCTCTGTGCCAAGACCAAAGAGG + Intronic
934045871 2:88172073-88172095 TTTCTGTGCCAGGGTGGGAGGGG - Exonic
935180907 2:100690597-100690619 TCTCTGTGCCAGGTCTAGAGGGG + Intergenic
935386262 2:102502722-102502744 TCCCTGTGCCAGGGCTGCAGTGG + Intronic
936944575 2:117918843-117918865 TTTCAGTGCCAGGGCCAGCAAGG - Exonic
937793939 2:125994726-125994748 TCTCTGGCCCAGGGCCACACTGG + Intergenic
938100512 2:128494990-128495012 TTTCTCTGACAGCGCCAGAGGGG + Intergenic
938233964 2:129686466-129686488 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
938808189 2:134825994-134826016 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
939470360 2:142613242-142613264 TGTCTGTGCCCTGCCCACAGAGG + Intergenic
939479284 2:142728405-142728427 TGTCTGTGCCCTGGCCCCAGAGG - Intergenic
940010587 2:149050626-149050648 CTGCTGTGCCAGCACCACAGAGG + Intronic
940195593 2:151091028-151091050 TTTCTATGCCAAGCCCACAGCGG - Intergenic
940573632 2:155472073-155472095 TGTCTGTGCCCTGCCCACAGAGG + Intergenic
940840929 2:158580943-158580965 GCTCTGTGCCAGGGCCATGGGGG - Intronic
941054076 2:160767033-160767055 TGTCTGTGCCCTGGCCCCAGAGG - Intergenic
941460583 2:165766689-165766711 TTCCTCTGCCAGGGCCAATGGGG + Intronic
943088774 2:183349390-183349412 TTTCCATGCCAGGGTCACAAAGG - Intergenic
943613968 2:190070093-190070115 TTCCTGGGTCAGTGCCACAGTGG + Intronic
945533981 2:210989226-210989248 TCTCTATGGCAGGGGCACAGTGG - Intergenic
946115033 2:217453820-217453842 TTTCTGGAGCAGGGCTACAGAGG - Intronic
946801330 2:223419126-223419148 GATCTGTGCCAGAGACACAGAGG + Intergenic
947163490 2:227237997-227238019 CTTCTGTGACGGGGCCAAAGGGG + Exonic
947935378 2:233999355-233999377 TTTCTGAGCCACAGCCTCAGGGG - Intronic
948339380 2:237237321-237237343 TTTCCCTGCCAGGGCTATAGTGG - Intergenic
949043632 2:241860430-241860452 TCTCTGTTCCAGGGCAGCAGTGG + Intergenic
1168981111 20:2004472-2004494 GTTCTGTGACAGCACCACAGAGG - Intergenic
1173258036 20:41408921-41408943 TTACTGGGCCAGGGCCAAGGTGG - Intronic
1173465654 20:43279073-43279095 TCTCTGTCCCAGGCCCCCAGGGG + Intergenic
1173730788 20:45327051-45327073 TTTTTCTGCCAGGGCAACTGAGG + Exonic
1173799101 20:45883654-45883676 TTTCTGAGCCAGAGCCAATGAGG - Exonic
1174008152 20:47427069-47427091 CTTCTGGGTAAGGGCCACAGAGG - Intergenic
1174419305 20:50389385-50389407 TGTCGGTGCCAGGGAAACAGTGG + Intergenic
1174925902 20:54759552-54759574 TTCCCCTGCCAGAGCCACAGGGG + Intergenic
1175920325 20:62447644-62447666 GTTCTGTACCTGGGCCACAGTGG - Intergenic
1176207567 20:63897795-63897817 GTGCTGTGACAGAGCCACAGAGG + Intronic
1176301894 21:5102468-5102490 CCTCTGTGCCAGGGCCATAGGGG + Intergenic
1176312812 21:5162614-5162636 GTTCTGGGCCAGGGCCGCTGTGG - Intergenic
1177560001 21:22738488-22738510 TTTCTGTCCCAGGAACACAAGGG + Intergenic
1178019920 21:28396194-28396216 TGTCTGTGCCACAGTCACAGGGG - Intergenic
1178815845 21:35928719-35928741 TTTCTGCTCCTGGGTCACAGGGG - Intronic
1179040504 21:37798249-37798271 CCTCTGTGCCTGGGGCACAGCGG + Intronic
1179397955 21:41058501-41058523 GTTCTGTGCCTTGGCCACTGGGG + Intergenic
1179844236 21:44099416-44099438 GTTCTGGGCCAGGGCCGCTGTGG + Intronic
1179855136 21:44159432-44159454 CCTCTGTGCCAGGGCCATAGGGG - Intergenic
1180317568 22:11288833-11288855 TGTCTGTGCCCTGCCCACAGTGG - Intergenic
1180736511 22:18021770-18021792 TTAATGTGCCAGGGCCACTGAGG - Intronic
1184025590 22:41853555-41853577 TCTCTGTGCCTGGTACACAGTGG + Intronic
1184224259 22:43120141-43120163 TTGGGGTGGCAGGGCCACAGGGG + Intronic
1184950906 22:47842087-47842109 TTTGTGTCCCAGGGCCCCAAGGG + Intergenic
1185137637 22:49081640-49081662 TTCCGGAGCCAGGGCTACAGTGG + Intergenic
1185249044 22:49789958-49789980 TGGCTGAGACAGGGCCACAGGGG - Intronic
949657806 3:6241281-6241303 TTTCTGTGAGAGGGCCCCATAGG - Intergenic
950111675 3:10422764-10422786 GTTCTGTGCCATGTCCACATGGG - Intronic
950442561 3:13018589-13018611 TTTGTCTGCCAGGGGCCCAGAGG + Intronic
950765136 3:15267793-15267815 TTTAAGTCCCAGGGCCCCAGTGG - Intronic
951037152 3:17945974-17945996 TTTCTAGGACAGGGCCACAAAGG - Intronic
951818608 3:26783645-26783667 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
955652515 3:61210382-61210404 TGTCTGTGCCCGGCCCCCAGAGG + Intronic
957018496 3:75097444-75097466 TTTCTGTGCCGTGCCCCCAGAGG + Intergenic
957020901 3:75125311-75125333 TTTCTGTGCCCTGACCCCAGAGG + Intergenic
957180670 3:76873935-76873957 TTTCTATTTCAAGGCCACAGGGG - Intronic
958252966 3:91291683-91291705 TTTCTGTGCCCTGACCCCAGAGG - Intergenic
959388674 3:105745299-105745321 TTTCTTGGCCAAAGCCACAGGGG + Intronic
960055349 3:113273008-113273030 TTTCTGTCCCAGGGCCAGATGGG - Intronic
960792923 3:121452797-121452819 TTTCTGTGCCCTGCCCCCAGAGG - Intronic
961629570 3:128286238-128286260 TATGTGTGCCAGAGCCACAAAGG - Intronic
961801734 3:129455941-129455963 ATGCTGTGCCAGGGAGACAGAGG + Intronic
962104455 3:132376692-132376714 TGTCTGTGCCCTGGCCCCAGAGG + Intergenic
962453851 3:135547203-135547225 TTCCCTTGCCAGAGCCACAGGGG + Intergenic
966136615 3:176706085-176706107 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
966138877 3:176732391-176732413 TGACTTTTCCAGGGCCACAGAGG - Intergenic
966262951 3:178001901-178001923 TTTGTGTGCCTGGGCCTCAGGGG + Intergenic
966624942 3:182005702-182005724 TTTCTGTGCCTGGGCCCCTCAGG - Intergenic
968516272 4:1016932-1016954 TGGCTGTGCCAGGCCCCCAGGGG - Intronic
968518911 4:1027016-1027038 TCGCTGGGCCAGAGCCACAGGGG + Intergenic
969252434 4:5976943-5976965 ATTCAGTGCCAGGCCCACAAAGG - Intronic
969436921 4:7193777-7193799 TTGCTGTGCCAGCGCCACACAGG - Intronic
970885672 4:20985012-20985034 GTTCTGTGCCAGGACCACACTGG + Intronic
971880625 4:32366011-32366033 TGTCTGTGCCCTGGCCCCAGAGG + Intergenic
972600137 4:40564927-40564949 CTTCTGAGCAAGGGCCCCAGAGG + Intronic
972996007 4:44880009-44880031 TTTCTGTGCCCTGCCCGCAGAGG - Intergenic
974694315 4:65345616-65345638 TTTCTCTGCAAGGGCCCTAGAGG - Intronic
976303276 4:83535633-83535655 TTTCTGTGCCAGGGAGATGGCGG + Intergenic
977505946 4:97904135-97904157 TTTCTGTGCCCTGCCCCCAGAGG - Intronic
977703684 4:100048982-100049004 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
978274695 4:106935651-106935673 TGTCTGTGCCCTGCCCACAGAGG - Intronic
978373259 4:108050446-108050468 TCGCTGTGCCAGGCCCACAGAGG + Intronic
979552452 4:122006285-122006307 ATTCTGTGACAGGTCCACAGAGG + Intergenic
980821989 4:138029275-138029297 TTTCTCTGCCAGGTCAACACAGG + Intergenic
981556720 4:146003323-146003345 TGTCTGTGCCATGTCCCCAGAGG + Intergenic
981958074 4:150503117-150503139 TGTCTGTGCCATGCCCCCAGAGG - Intronic
982581138 4:157180346-157180368 TGTCTGTGCCCTGCCCACAGAGG + Intergenic
986383257 5:7207499-7207521 TCTCTGTGCAAGGGACTCAGTGG - Intergenic
986940005 5:12937772-12937794 TACCTGTGCCAGAGTCACAGGGG - Intergenic
987335903 5:16897619-16897641 TCTCTGTGCAAATGCCACAGAGG + Intronic
988391005 5:30630979-30631001 TCTCTGTGCTAGGTCCACACTGG + Intergenic
988556395 5:32239774-32239796 TTTCTGTTTGAGGGGCACAGAGG + Intronic
989968164 5:50489567-50489589 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
992269683 5:75052676-75052698 CTTCTGCGCCAGGGCAACCGGGG - Intergenic
992576491 5:78118738-78118760 TGTCTGTGCCCTGGCCCCAGAGG - Intronic
994193366 5:96894021-96894043 TGTCTTTGCCAGGGACAGAGGGG - Intronic
995697775 5:114899483-114899505 TTGCTCTGCCTGGGCCAGAGGGG - Intergenic
996948570 5:129098057-129098079 TACGTGAGCCAGGGCCACAGAGG - Intronic
999435820 5:151562537-151562559 CTTCTGTGCCAGGTCTACAAAGG + Intronic
1001213880 5:169837215-169837237 TTTCTTTGCCAAGGCCATAATGG + Intronic
1001294552 5:170489816-170489838 TTTCTTTGCTAGGGACCCAGTGG - Intronic
1001407593 5:171486922-171486944 TTTTTGGGCCAGGCCCAAAGTGG - Intergenic
1001557385 5:172646082-172646104 TTTCTTTCCCTGGGACACAGCGG + Intronic
1001570666 5:172728522-172728544 TCTCTCTGCCTGGGCCACACTGG - Intergenic
1001713815 5:173798514-173798536 TCTATGTTCCATGGCCACAGGGG - Intergenic
1002409852 5:179065262-179065284 TTTGTGTGCCAGGGCCCCCCAGG + Intronic
1002598719 5:180341082-180341104 CTTCTGGACCAGAGCCACAGGGG + Intronic
1004070499 6:12292776-12292798 TTTCAGTGAGAGGGCCTCAGGGG + Intronic
1004917219 6:20343101-20343123 TTTAGGTGCCAGTGCCACATTGG + Intergenic
1005092115 6:22068397-22068419 TTTCTGTTCCAGGGTCATACTGG + Intergenic
1005199448 6:23326496-23326518 TTTCTGTGAAAGAGGCACAGCGG - Intergenic
1007557830 6:42782047-42782069 TTTCTGCGCCATCGCAACAGGGG - Exonic
1007852767 6:44821136-44821158 TTTCTCAGACCGGGCCACAGTGG - Intronic
1008628558 6:53342376-53342398 TTGCTGTGCCAAGACCAAAGAGG + Intronic
1009060674 6:58394339-58394361 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1009876819 6:69515687-69515709 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1010443999 6:75930990-75931012 CCTTTGTGCCAGGGCCACAGAGG + Exonic
1011179982 6:84608985-84609007 TGTCTGTGCCCGGCCCCCAGAGG - Intergenic
1014953576 6:127588821-127588843 ATTTTGAGCAAGGGCCACAGAGG - Intronic
1015784576 6:136908859-136908881 TTTTTGGGTCAGGGGCACAGTGG - Intronic
1016719787 6:147282760-147282782 TTCCTGGGCCAGGGCCTCACAGG + Intronic
1017236564 6:152122625-152122647 TTTCTGAGCCAGGGCCAGGTCGG - Exonic
1018365867 6:163119160-163119182 TTTAACTGCGAGGGCCACAGAGG + Intronic
1021315523 7:19144077-19144099 TCCTTGTCCCAGGGCCACAGTGG - Intergenic
1021911796 7:25392873-25392895 CTTCTGTCCCAGGGCGACACTGG - Intergenic
1022439913 7:30424774-30424796 TTTGGATGCCAGGGCCACAGGGG + Exonic
1022522056 7:31014841-31014863 TTACTGTGCCCTGGCCTCAGAGG + Intergenic
1023891225 7:44393228-44393250 TGTCTGTGCCATCCCCACAGAGG - Intronic
1024046634 7:45589852-45589874 TTTCCTTTCCAGGGCCACGGGGG + Intronic
1024453849 7:49580323-49580345 TTTCTGAGCCAGGGCATCAGGGG - Intergenic
1024883178 7:54112309-54112331 TTTCTGTGCCAGAGACAGACAGG - Intergenic
1025601139 7:62998783-62998805 TGTCTGTGCCAAGCCCCCAGAGG + Intergenic
1026848210 7:73709298-73709320 TCTCTGTGCCGGGCCCCCAGTGG - Intronic
1027152443 7:75742147-75742169 TTTTTGTGGCCGTGCCACAGTGG + Intergenic
1027455748 7:78389519-78389541 TATCTCTCCCAGTGCCACAGCGG - Intronic
1027523188 7:79235250-79235272 TGTCTGTGCCCTGCCCACAGAGG + Intronic
1028563184 7:92197964-92197986 TTTATGTGCCAGGGACCCAGTGG - Intergenic
1029965573 7:104736158-104736180 TTTCTGTGGCAGGGGAAGAGGGG + Intronic
1032076770 7:128839794-128839816 TTTCCGAGCCAGTGCCACTGGGG - Intronic
1032265200 7:130365766-130365788 TTTCTGTGCGTGGGCCGCAAAGG + Intronic
1032506874 7:132442253-132442275 TTCTTGTGTCAGGGCCACAGAGG + Intronic
1033573593 7:142658043-142658065 TTTTTGTGCCTGGGCCTCACTGG - Intergenic
1033586446 7:142778259-142778281 TTTGTCACCCAGGGCCACAGTGG + Intergenic
1034010895 7:147528336-147528358 TCTCTGTGCGAAGGCCACATTGG + Intronic
1034254578 7:149717546-149717568 TACCTGGGCCAGAGCCACAGAGG + Intronic
1036659977 8:10701637-10701659 CTTCTCTGCCAGGGCTGCAGAGG - Intronic
1037183363 8:16033053-16033075 TGTCTGTGCCCTGCCCACAGAGG - Intergenic
1037892064 8:22628746-22628768 TTTCTGTGCCAGGGCCACAGGGG - Intronic
1038696563 8:29812015-29812037 TATCTATGCCAGAGCCACTGAGG + Intergenic
1038877403 8:31566658-31566680 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1039303111 8:36231517-36231539 TTTCTGAGTAAGGACCACAGAGG + Intergenic
1040686655 8:49880695-49880717 TGTCTGTGCCCTGGCCCCAGAGG + Intergenic
1041035571 8:53786114-53786136 TGTCTGTGCCATGCCCCCAGAGG + Intronic
1041885321 8:62801176-62801198 TTTCTGTGCCCTGCCCCCAGAGG - Intronic
1042115506 8:65426906-65426928 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1042733488 8:71962614-71962636 TCTCAGTGCCTGGGACACAGCGG + Intronic
1042755936 8:72210940-72210962 TTACTGTGTCAGGAGCACAGTGG - Intergenic
1042825519 8:72975540-72975562 GTTCTGTGCCTGGGCCTTAGAGG + Intergenic
1043545082 8:81306480-81306502 GTGCTGTTGCAGGGCCACAGTGG + Intergenic
1043594138 8:81864271-81864293 TTTCTGGGCCAGGGCAGGAGTGG + Intergenic
1044848723 8:96407261-96407283 TGGCTGTGCCTGGGCCTCAGGGG + Intergenic
1044852506 8:96442842-96442864 TTTCTGGGACAGGGCCCCTGTGG + Intergenic
1046896505 8:119479325-119479347 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1048024189 8:130569399-130569421 TTTATGTGGCAGGGCCACGCTGG + Intergenic
1049241436 8:141539352-141539374 TTCCTGTGCAAGGGCCTCGGCGG + Intergenic
1049590926 8:143462130-143462152 TCCCTGTGCCAGGGCCACCCAGG + Intronic
1050370881 9:4920619-4920641 TGTCTGTGCCATGCCCCCAGAGG + Intergenic
1051223588 9:14876259-14876281 TTTCTGTGCCCTGCCCCCAGAGG + Intronic
1051528216 9:18071143-18071165 ATTCTGTGACAGAGCCACTGTGG + Intergenic
1053131567 9:35618505-35618527 TCCCTGGGCCAGGGCCAGAGGGG + Intronic
1053199896 9:36145165-36145187 GTTCTGAGTGAGGGCCACAGAGG - Intronic
1053386315 9:37693367-37693389 TCTCTGTGGCAGGGCCAGATGGG - Intronic
1056114371 9:83427310-83427332 TTATTGTGACAGGGCCAGAGGGG - Intronic
1056767660 9:89454844-89454866 GTCCTGTGCCAGGGCCCCACTGG - Intronic
1056963512 9:91147116-91147138 TTACTGTGACATGCCCACAGGGG + Intergenic
1057167446 9:92940258-92940280 TTGCTGCACCAGGGCCACACAGG - Intergenic
1057576083 9:96243969-96243991 GTTCTGTACCAGGGTCAGAGAGG + Intronic
1059421975 9:114197794-114197816 TGTCTAGGCCAGGGCCAGAGGGG - Intronic
1059967155 9:119626781-119626803 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1060196079 9:121624198-121624220 TGTCTGTGCCACGGACCCAGCGG + Intronic
1060976638 9:127768797-127768819 TTGCTCTGCCCCGGCCACAGTGG + Intronic
1061632642 9:131882852-131882874 GTTAGGTGCCAGGGCCACAGAGG - Intronic
1062052793 9:134456184-134456206 CTGCTGGGCCAGGGCCGCAGCGG + Intergenic
1203365798 Un_KI270442v1:254568-254590 TGTCTGTGCCCTGCCCACAGAGG - Intergenic
1186378343 X:9032876-9032898 TTTCTGCGCTGGGGGCACAGGGG - Intronic
1187526669 X:20060866-20060888 TGTCTGTGCCAGGGCAGAAGTGG - Intronic
1187602342 X:20845994-20846016 TGTCTGTGCCCTGCCCACAGAGG - Intergenic
1190339867 X:49287570-49287592 TTTCTGTGGGAGGATCACAGTGG + Exonic
1190358179 X:49625630-49625652 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1190962293 X:55264610-55264632 TTTCTGGGCCAGGACGACGGAGG - Exonic
1191114841 X:56841751-56841773 TGTCTGTGCCATGCCCCCAGAGG + Intergenic
1191848898 X:65571040-65571062 TCTCTGTTCCAGGGCCATGGTGG + Intergenic
1192979871 X:76328247-76328269 TGTCTGTGCCCTGCCCACAGAGG + Intergenic
1193182900 X:78479670-78479692 TATCAGTGCCAGTGGCACAGGGG + Intergenic
1193582917 X:83286847-83286869 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1193620865 X:83751047-83751069 TGTCTGTGCCATGCCCCCAGAGG - Intergenic
1194746375 X:97632947-97632969 TTTTTGTGACAGGGAAACAGTGG - Intergenic
1195147507 X:102031990-102032012 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1195732972 X:107984043-107984065 AGCCTGTGCAAGGGCCACAGAGG - Intergenic
1196160231 X:112474768-112474790 TGTCTGTGCCAGGCCCCCACTGG + Intergenic
1196473204 X:116052357-116052379 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1196672358 X:118382154-118382176 TCTCTGTGCCAGGCCTAAAGTGG + Intronic
1197481627 X:126994177-126994199 ATTCTCTGGCAGGGCCCCAGCGG + Intergenic
1197970647 X:132111523-132111545 GTTCTGGGCCAGTGCCAGAGTGG - Intronic
1198274298 X:135087037-135087059 TTTCTGCCCCATGGGCACAGCGG - Intergenic
1198567405 X:137918464-137918486 TTCCAGTGCCAGGGCCCCAGTGG + Intergenic
1199672421 X:150158563-150158585 TTTCTATTCCAGGCCCTCAGGGG - Intergenic
1200321902 X:155198169-155198191 TGTCTGTGCCATGCCCCCAGAGG - Intronic
1200772042 Y:7135149-7135171 TTTCTGTGCCCTGTCCCCAGAGG - Intergenic
1201397469 Y:13564725-13564747 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1201519905 Y:14861643-14861665 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1201710427 Y:16985590-16985612 TGTCTGTGCCCTGCCCACAGAGG - Intergenic
1201991450 Y:20031493-20031515 TTTCTGTGCCCTGCCCCCAGAGG - Intergenic
1202064617 Y:20925436-20925458 TTTCTGTGCCCTGCCCCCAGAGG + Intergenic
1202267672 Y:23037790-23037812 TGCCTGTGCCAGAGCCACAGAGG + Intergenic
1202270892 Y:23073139-23073161 TGCCTGTGCCAGAGCCACAGAGG + Intergenic
1202295134 Y:23347543-23347565 TGCCTGTGCCAGAGCCACAGAGG - Intergenic
1202420664 Y:24671534-24671556 TGCCTGTGCCAGAGCCACAGAGG + Intergenic
1202423887 Y:24706883-24706905 TGCCTGTGCCAGAGCCACAGAGG + Intergenic
1202446902 Y:24963202-24963224 TGCCTGTGCCAGAGCCACAGAGG - Intergenic
1202450122 Y:24998548-24998570 TGCCTGTGCCAGAGCCACAGAGG - Intergenic